European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:ACS-GH001-3'
Entry information
Entry name QT-EVE-GH-002;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-GH001-3
Description
Description Quantitative PCR method for detection of cotton event LLCotton25 (Mazzara et al., 2007).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event LLCotton25 (ACS-GH001-3)
References
1 Mazzara M., Grazioli E., Savini C., Van Den Eede G.; "Event-Specific Method for the Quantification of Cotton Line "LLCotton25" Using Real-time PCR - Validation Report and Protocol - Cotton Seeds Sampling and DNA Extraction" Online Publication (2007)
DOI 10.2788/32755
Reference Position 1-79
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GH-002.pdf
Reference Position 1-79
Cross-references
GMOMETHODS QT-TAX-GH-018;
Features
Key Location Qualifier Value
STS 1..79 standard_namePCR 79 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of cotton event LLCotton25 and the cotton host genome
primer_b 1..20 standard_namePrimer forward: KVM156
noteCAAGGAACTATTCAACTGAG
target5'-host genome
primer_b 21..46 standard_nameRT-PCR probe: TM018
noteFAM-CTTAACAGTACTCGGCCgTCGACCGC-TAMRA
primer_b complement(56..79) standard_namePrimer reverse: KVM155
noteCAGATTTTTGTGGGATTGGAATTC
targetinsert
Sequence information
Length: 79 BP, A Count: 23, C Count: 21, T Count: 14, G Count: 12
caaggaacta ttcaactgag cttaacagta ctcggccgtc gaccgcnnnn nnnnngaatt        60
ccaatcccac aaaaatctg                                                     79