European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:DAS-24236-5'
Entry information
Entry name QT-EVE-GH-001a;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier DAS-24236-5
Description
Description Quantitative PCR method for detection of cotton event 281-24-236 (Mazzara et al., 2006).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event 281-24-236 (DAS-24236-5)
References
1 Mazzara M., Larcher S., Savini C., Charles Delobel C., Van Den Eede G.; "Event-Specific Methods for the Quantitation of the Hybrid Cotton Line 281-24-236/3006-210-23 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Cotton Seeds" Online Publication (2006)
DOI 10.2788/32649
Reference Position 1-111
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-GH-001a.pdf
Reference Position 1-111
Cross-references
GMOMETHODS QT-TAX-GH-016;
QT-TAX-GH-021;
Features
Key Location Qualifier Value
STS 1..111 standard_namePCR 111 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of cotton event 281-24-236 and the cotton host genome
primer_b 1..25 standard_namePrimer forward: 281-f1
noteCTCATTGCTGATCCATGTAGATTTC
targetinsert
primer_b complement(32..64) standard_nameRT-PCR probe: 281-s2
noteFAM-TTGGGTTAATAAAGTCAGATTAGAGGGAGACAA-TAMRA
primer_b complement(92..111) standard_namePrimer reverse: 281-r2
noteGGACAATGCTGGGCTTTGTG
target3'-host genome
Sequence information
Length: 111 BP, A Count: 19, C Count: 24, T Count: 26, G Count: 9
ctcattgctg atccatgtag atttcnnnnn nttgtctccc tctaatctga ctttattaac        60
ccaannnnnn nnnnnnnnnn nnnnnnnnnn ncacaaagcc cagcattgtc c                111