European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'id:QT-eve-BV*'
Entry information
Entry name QT-EVE-BV-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier KM-000H71-4
Description
Description Quantitative PCR method for detection of sugar beet event H7-1 (Mazzara et al., 2006).
Keywords event_specific.
From Beta vulgaris (sugar beet) - event H7-1 (KM-000H71-4)
References
1 Mazzara M., Foti N., Savini C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Sugarbeet Line H7-1 Using Real-Time PCR - Validation Report and Protocol Online Publication (2006)
DOI 10.2788/32035
Reference Position 1-108
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-BV-001.pdf
Reference Position 1-108
Cross-references
GMOMETHODS QT-TAX-BV-013;
Features
Key Location Qualifier Value
STS 1..108 standard_namePCR 108 bp amplicon
noteevent-specific RT-PCR
target5' integration border region (IBR) between the insert of sugar beet event H7-1 and the sugar beet host genome
primer_b 1..22 standard_namePrimer forward: H7PLT1
noteTGGGATCTGGGTGGCTCTAACT
target5'-host genome
primer_b 51..70 standard_nameRT-PCR probe: ZRH7
noteFAM-AAGGCGGGAAACGACAATCT-TAMRA
primer_b complement(90..108) standard_namePrimer reverse: ZRH7-R2
noteAATGCTGCTAAATCCTGAG
targetinsert
Sequence information
Length: 108 BP, A Count: 16, C Count: 12, T Count: 15, G Count: 18
tgggatctgg gtggctctaa ctnnnnnnnn nnnnnnnnnn nnnnnnnnnn aaggcgggaa        60
acgacaatct nnnnnnnnnn nnnnnnnnnc tcaggattta gcagcatt                    108