European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:ACS-BN003-6'
Entry information
Entry name QT-EVE-BN-003;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-BN003-6
Description
Description Quantitative PCR method for detection of oilseed rape event Rf3 (Savini et al., 2007).
Keywords event_specific.
From Brassica napus (oilseed rape) - event Rf3 (ACS-BN003-6)
References
1 Savini C., Bogni A., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Oilseed Rape Line Rf3 Using Real-time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction" Online Publication (2007)
DOI 10.2788/28179
Reference Position 1-139
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-BN-003.pdf
Reference Position 1-139
Cross-references
GMOMETHODS QT-TAX-BN-012;
Features
Key Location Qualifier Value
STS 1..139 standard_namePCR 139 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of oilseed rape event Rf3 and the oilseed rape host genome
primer_b 1..24 standard_namePrimer forward: DPA165
noteCATAAAGGAAGATGGAGACTTGAG
targetinsert
primer_b complement(88..112) standard_nameRT-PCR probe: TM010
noteFAM-CGCACGCTTATCGACCATAAGCCCA-TAMRA
primer_b complement(115..139) standard_namePrimer reverse: KVM084
noteAGCATTTAGCATGTACCATCAGACA
target3'-host genome
Sequence information
Length: 139 BP, A Count: 20, C Count: 10, T Count: 20, G Count: 24
cataaaggaa gatggagact tgagnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnntgg gcttatggtc gataagcgtg cgnntgtctg       120
atggtacatg ctaaatgct                                                    139