European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'ac:ACS-BN005-8'
Entry information
Entry name QT-EVE-BN-002;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier ACS-BN005-8
Description
Description Quantitative PCR method for detection of oilseed rape event Ms8 (Mazzara et al., 2007).
Keywords event_specific.
From Brassica napus (oilseed rape) - event Ms8 (ACS-BN005-8)
References
1 Mazzara M., Bogni A., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Oilseed Rape Line Ms8 Using Real-time PCR - Validation Report and Protocol- Seeds Sampling and DNA Extraction of Oilseed Rape" Online Publication (2007)
DOI 10.2788/33880
Reference Position 1-130
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-EVE-BN-002.pdf
Reference Position 1-130
Cross-references
GMOMETHODS QT-TAX-BN-012;
Features
Key Location Qualifier Value
STS 1..130 standard_namePCR 130 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of oilseed rape event Ms8 and the oilseed rape host genome
primer_b 1..31 standard_namePrimer forward: KVM085
noteGTTAGAAAAAGTAAACAATTAATATAGCCGG
targetinsert
primer_b 52..79 standard_nameRT-PCR probe: TM011
noteFAM-AATATAATCGACGGATCCCCGGGAATTC-TAMRA
primer_b complement(111..130) standard_namePrimer reverse: HCA048
noteGGAGGGTGTTTTTGGTTATC
target3'-host genome
unsure 129..130 old_locus_tag'C' ?
noteAccording to Protocol PGS0319, Annex 2.2, Version B provided by BayerCropScience this 'C' is not demonstrated any more. It is not defined if it is just excuded from the PCR amplicon/ rev-Primer or if its existence is unclear!
Sequence information
Length: 130 BP, A Count: 33, C Count: 18, T Count: 15, G Count: 13
gttagaaaaa gtaaacaatt aatatagccg gnnnnnnnnn nnnnnnnnnn naatataatc        60
gacggatccc cgggaattcn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn gataaccaaa       120
aacaccctcc                                                              130