Only one hit for query 'ac%3AACS-BN005-8'
ID QT-EVE-BN-002; SV 0; linear; genomic DNA; STS; SYN; 130 BP. XX AC ACS-BN005-8; XX DT 31-MAY-2006 DT 04-NOV-2010 XX DE Quantitative PCR method for detection of oilseed rape event Ms8 DE (Mazzara et al., 2007). XX KW event_specific. XX OS Brassica napus (oilseed rape) - event Ms8 (ACS-BN005-8) XX RN [1] RP 1-130 RA Mazzara M., Bogni A., Savini C., Van Den Eede G.; RT "Event-specific Method for the Quantification of Oilseed Rape Line Ms8 Using Real-time PCR - Validation Report and Protocol- Seeds Sampling and DNA Extraction of Oilseed Rape"; RL Online Publication (2007). RX DOI=10.2788/33880 XX RN [2] RP 1-130 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-EVE-BN-002.pdf XX DR GMOMETHODS; QT-TAX-BN-012; XX FH Key Location/Qualifiers FH FT STS 1..130 FT /standard_name="PCR 130 bp amplicon" FT /note="event-specific RT-PCR" FT /target="3' integration border region (IBR) between the insert of oilseed rape event Ms8 and the oilseed rape host genome" FT primer_bind 1..31 FT /standard_name="Primer forward: KVM085" FT /note="GTTAGAAAAAGTAAACAATTAATATAGCCGG" FT /target="insert" FT primer_bind 52..79 FT /standard_name="RT-PCR probe: TM011" FT /note="FAM-AATATAATCGACGGATCCCCGGGAATTC-TAMRA" FT primer_bind complement(111..130) FT /standard_name="Primer reverse: HCA048" FT /note="GGAGGGTGTTTTTGGTTATC" FT /target="3'-host genome" FT unsure 129..130 FT /old_locus_tag="'C' ?" FT /note="According to Protocol PGS0319, Annex 2.2, Version FT B provided by BayerCropScience this 'C' is not FT demonstrated any more. It is not defined if it is just FT excuded from the PCR amplicon/ rev-Primer or if its FT existence is unclear!" XX SQ Sequence 130 BP; 33 A; 18 C; 13 G; 15 T; 51 other; gttagaaaaa gtaaacaatt aatatagccg gnnnnnnnnn nnnnnnnnnn naatataatc 60 gacggatccc cgggaattcn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn gataaccaaa 120 aacaccctcc 130 //