ID QT-CON-00-006; SV 0; linear; genomic DNA; STS; SYN; 127 BP. XX AC SYN-BT011-1; XX DT 15-SEP-2009 DT 05-OCT-2016 XX DE Quantitative PCR method for detection of the junction between the intron 6 from maize alcohol dehydrogenase 1 gene and the synthetic cry1A(b) gene. XX KW construct_specific. XX OS Zea mays (maize) - event Bt11 (SYN-BT011-1) XX RN [1] RP 1-127 RA Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., RA Akiyama H., Goda Y., Toyoda M., Hino A.; RT "Validation of real-time PCR analyses for line-specific quantitation of RT genetically modified maize and soybean using new reference molecules"; RL J AOAC Int 85:1119-1126 (2002). RX PUBMED; 12374412. XX RN [2] RP 1-127 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-127 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-CON-00-006.pdf XX DR GMOMETHODS; QT-TAX-ZM-006; XX FH Key Location/Qualifiers FH FT STS 1..127 FT /standard_name="PCR 127 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between the Intron 6 (IVS6) from maize alcohol dehydrogenase 1 gene (adh1-1S) and a synthetic cry1A(b) gene" FT primer_bind 1..20 FT /standard_name="Primer forward: Bt11 3-5'" FT /note="AAAAGACCACAACAAGCCGC" FT /target="IVS 6 adh1" FT primer_bind 21..104 FT /standard_name="RT-PCR probe: Bt11-2-Taq" FT /note="FAM-CGACCATGGACAACAACCCAAACATCA-TAMRA" FT primer_bind complement(105..127) FT /standard_name="Primer reverse: Bt11 3-3'" FT /note="CAATGCGTTCTCCACCAAGTACT" FT /target="cry1A(b)" XX SQ Sequence 127 BP; 16 A; 10 C; 11 G; 6 T; 84 other; aaaagaccac aacaagccgc nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnagtact tggtggagaa 120 cgcattg 127 //