European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'id:QL-PLN*'
Entry information
Entry name QL-PLN-00-007;
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of chloroplast tRNA-Leu intron (ISO/FDIS 21569:2005).
Keywords plant_specific.
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Qualitative nucleic acid based methods" ISO 21569:1-69 (2005)
ISO 34614
Reference Position 1-571
2 "Detection of a genetic modification of potatoes by amplification of the modified DNA sequence using the polymerase chain reaction (PCR) and hybridization of the PCR product with a DNA probe, No. L24.01-1" Online Publication (1997)
Reference Position 1-571
3 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-PLN-00-007.pdf
Reference Position 1-571
Comment
A 500 bp to 600 bp DNA fragment is amplified from the chloroplast tRNA gene of different plant species. The amplicon here described is amplified from a sample of Solanum tuberosum L.(potato)
Features
Key Location Qualifier Value
STS 1..571 standard_namePCR 571 bp amplicon
noteplant-specific PCR
targetchloroplast tRNA-Leu (trnL) intron
primer_b 1..20 standard_namePrimer forward: A1
noteCGAAATCGGTAGACGCTACG
targettrnL
primer_b complement(552..571) standard_namePrimer reverse: A2
noteGGGGATAGAGGGACTTGAAC
targettrnL
Sequence information
Length: 571 BP, A Count: 216, C Count: 96, T Count: 150, G Count: 109
cgaaatcggt agacgctacg nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       420
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       480
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       540
nnnnnnnnnn ngttcaagtc cctctatccc c                                      571