Only one hit for query 'id%3AQL-ELE*%26ft%3A%27E9%27'
ID QL-ELE-00-024; SV 1; linear; genomic DNA; STD; PLN; 87 BP. XX AC ; XX DT 20-FEB-1985 DT 22-DEC-2016 XX DE Qualitative PCR method for detection of tE9 terminator (Debode et al., 2016). XX KW element_specific. XX RN [1] RP 1-87 RA Debode F., Huber I., Macarthur R., Rischitor P.E., Mazzara M., Herau V., Sebah D., Dobnik D., Broeders S., Roosens N.H., Busch U., Berben G., Morisset D., Zel J.; RT "Inter-laboratory studies for the validation of two singleplex (tE9 and pea lectin) and one duplex (pat/bar) real-time PCR methods for GMO detection"; RL Food Control 73:452-461 (2017). RX DOI=10.1016/j.foodcont.2016.08.037. XX RN [2] RP 1-87 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2016). RX PCR=QL-ELE-00-024.pdf XX FH Key Location/Qualifiers FH FT STS 1..87 FT /standard_name="PCR 87 bp amplicon" FT /note="element-specific PCR" FT /target="Terminator of the pea ribulose-1,5-bisphosphate carboxylase small subunit (rbcS) E9 gene" FT primer_bind 1..23 FT /standard_name="Primer forward: T-E9-R" FT /note="TTTTTATTCGGTTTTCGCTATCG" FT /target="T-E9" FT primer_bind complement(25..60) FT /standard_name="RT-PCR probe: T-E9-P" FT /note="FAM-TCATTAACTCTTCTCCATCCATTTCCATTTCACAGT-TAMRA" FT primer_bind complement(62..87) FT /standard_name="Primer reverse: T-E9-F" FT /note="TGAGAATGAACAAAAGGACCATATCA" FT /target="T-E9" XX SQ Sequence 87 BP; 23 A; 10 C; 20 G; 34 T; 0 other; tttttattcg gttttcgcta tcgaactgtg aaatggaaat ggatggagaa gagttaatga 60 atgatatggt ccttttgttc attctca 87 //