Only one hit for query 'id%3AQL-ELE*%26ft%3ApCambia'
ID QL-ELE-00-023; SV 1; circular; other DNA; STD; SYN; 137 BP. XX AC ; XX DT 24-APR-2000 DT 21-DEC-2016 XX DE Qualitative PCR method for detection of T35S pCAMBIA sequences (Rischitor et al., 2016). XX KW element_specific. XX RN [1] RP 1-137 RA Rischitor P., Lievens A., Mazzara M.; RT " Element-specific method for t35S-pCAMBIA detection using real-time PCR - Validation Report Qualitative Screening Method"; RL Online Publication (2016). XX RN [2] RP 1-137 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2016). RX PCR=QL-ELE-00-023.pdf XX FH Key Location/Qualifiers FH FT STS 1..137 FT /standard_name="PCR 137 bp amplicon" FT /note="element-specific PCR" FT /target="Cauliflower Mosaic Virus 35S terminator (CaMV T-35S) in pCAMBIA vector" FT primer_bind 1..21 FT /standard_name="Primer forward: t35S pCAMBIA c-F" FT /note="CGGGGGATCTGGATTTTAGTA" FT /target="T35S pCAMBIA" FT primer_bind complement(115..137) FT /standard_name="Primer reverse: t35S pCAMBIA a-R" FT /note="AGGGTTCCTATAGGGTTTCGCTC" FT /target="T35S pCAMBIA" XX SQ Sequence 137 BP; 45 A; 19 C; 27 G; 46 T; 0 other; cgggggatct ggattttagt actggatttt ggttttagga attagaaatt ttattgatag 60 aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac acatgagcga 120 aaccctatag gaaccct 137 //