European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'id:QL-ELE*&ft:Cry1A(b)*'
Entry information
Entry name QL-ELE-00-020;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of cry1A(b) gene (Barbau-Piednoir et al., 2014).
Keywords element_specific.
1 Barbau-Piednoir E., Stragier P., Roosens N., Mazzara M., Van den Eede G., Van den Bulcke M.; "Inter-laboratory Testing of GMO Detection by Combinatory SYBR Green PCR Screening(CoSYPS)" Food Analitical Methods 0:0-0 (2014)
DOI 10.1007/s12161-014-9837-3
Reference Position 1-73
2 "PCR reactions set up and amplification conditions" Online Publication (2014)
PCR QL-ELE-00-020.pdf
Reference Position 1-73
Cross-references
GMOMETHODS QL-TAX-BN-003;
QL-TAX-GM-001;
QL-TAX-ZM-002;
QL-PLN-00-006;
Features
Key Location Qualifier Value
misc_fea 1..73 noteSybricon020 insert containing partial Bacillus thuringiensis Cry1A(b) gene isolated from Zea mays MON810
STS 1..73 standard_namePCR 73 bp amplicon
noteelement-specific PCR
targetcry1A(b) synthetic construct derived from Bacillus thuringiensis
primer_b 1..19 standard_namePrimer reverse: Cry1Ab_Bt_Cott_Rev
noteCAGCACCTGGCACGAACTC
targetcry1A(b)
primer_b complement(54..73) standard_namePrimer forward: Cry1Ab_Bt_Cott_Fwd
noteACCGGTTACACTCCCATCGA
targetcry1A(b)
Sequence information
Length: 73 BP, A Count: 18, C Count: 15, T Count: 11, G Count: 29
cagcacctgg cacgaactcn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnntcgatgg        60
gagtgtaacc ggt                                                           73