European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Only one hit for query 'id:QL-ELE*&ft:Cry1Ab'
Entry information
Entry name QL-ELE-00-016;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of cry1Ab/Ac gene (Grohmann et al., 2015).
Keywords element_specific.
1 Grohmann L., Reiting R., Maede D., Uhlig S., Simon K., Frost K., Jit Randhawa G., Zur K.; "Collaborative trial validation of cry1Ab/Ac and Pubi-cry TaqMan-based real-time PCR assays for detection of DNA derived from genetically modified Bt plant products" Accred Qual Assur 20:85-96 (2015)
DOI 10.1007/s00769-015-1108-5
Reference Position 1-74
2 "Detection of genetically modified cry1Ab/Ac and P-ubi-cry DNA sequences in rice products using real-time PCR" BVL L 15.06-3:2013-08 (2013)
BVL bvl-l-1506-3/193413251
Reference Position 1-74
3 "PCR reactions set up and amplification conditions" Online Publication (2014)
PCR QL-ELE-00-016.pdf
Reference Position 1-74
Features
Key Location Qualifier Value
STS 1..74 standard_namePCR 74 bp amplicon
noteelement-specific RT-PCR
targetcry1Ab/Ac synthetic construct derived from Bacillus thuringiensis
primer_b 1..24 standard_namePrimer forward: Bt-F1
noteGAGGAAATGCGTATTCAATTCAAC
targetcry1Ab/Ac
primer_b 26..50 standard_nameRT-PCR probe: Bt-P
noteFAM-ACATGAACAGCGCCTTGACCACAGC-NFQ
primer_b complement(55..74) standard_namePrimer reverse: Bt-R
noteTTCTGGACTGCGAACAATGG
targetcry1Ab/Ac
Sequence information
Length: 74 BP, A Count: 23, C Count: 20, T Count: 16, G Count: 15
gaggaaatgc gtattcaatt caacnacatg aacagcgcct tgaccacagc nnnnccattg        60
ttcgcagtcc agaa                                                          74