European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-CON-00-007;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of the junction between a cry1A(b)/cry1A(c) fusion gene and DNA spacer sequences (Grohmann and Maede, 2009).
Keywords construct_specific.
From Oryza sativa (rice) - event Bt63
References
1 Grohmann L., Maede D.; "Detection of genetically modified rice: collaborative validation study of a construct-specific real-time PCR method for detection of transgenic Bt rice" Eur. Food Res. Technol. 228:497-500 (2009)
DOI 10.1007/s00217-008-0964-1
Reference Position 1-83
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QL-CON-00-007.pdf
Reference Position 1-83
Cross-references
GMOMETHODS QL-TAX-OS-003;
Features
Key Location Qualifier Value
STS 1..83 standard_namePCR 83 bp amplicon
noteconstruct-specific RT-PCR
targetJunction region between the cry1A(b)/cry1A(c) fusion gene and the DNA spacer sequences linking the fusion gene to the nopaline synthase terminator (T-nos)
primer_b 1..25 standard_namePrimer forward: T51F
noteGACTGCTGGAGTGATTATCGACAGA
targetcry1Ac
primer_b 26..59 standard_nameRT-PCR probe: T51p
noteFAM-TCGAGTTCATTCCAGTTACTGCAACACTCGAG-TAMRA
primer_b complement(60..83) standard_namePrimer reverse: T51R
noteAGCTCGGTACCTCGACTTATTCAG
targetDNA spacer sequences
Sequence information
Length: 83 BP, A Count: 14, C Count: 9, T Count: 11, G Count: 15
gactgctgga gtgattatcg acagannnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnc        60
tgaataagtc gaggtaccga gct                                                83