European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-ZM-002;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of maize high-mobility-group gene
Keywords taxon_specific, validated_in_combination.
From Zea mays (maize)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods" ISO 21570:1-103 (2005)
ISO 34615
Reference Position 1-79
2 Mazzara M., Grazioli E., Savini C., Van Den Eede G.; "Report on the Verification of the Performance of a MON810 Event-specific Method on Maize Line MON810 Using Real-time PCR - Validation Report and Protocol" Online Publication (2009)
DOI 10.2788/59036
Reference Position 1-79
3 Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line TC1507 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7" Online Publication (2005)
BSHOP LBNA21828
Reference Position 1-79
4 Mazzara M., Grazioli E., Larcher S., Savini C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line DAS-59122-7 Using Real-Time PCR - Validation Report and Protocol" Online Publication (2006)
DOI 10.2788/31820
Reference Position 1-79
5 Charles Delobel C., Grazioli E., Larcher S., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/43570
Reference Position 1-79
6 Charles Delobel C., Foti N., Grazioli E., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MON88017 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/43272
Reference Position 1-79
7 Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/68713
Reference Position 1-79
8 Savini C., ; "Event-specific Method for the Quantification of Maize 98140 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF DP-098140-6_validated_Method.pdf
EURL_GMFF DP-098140-6_val_report.pdf
Reference Position 1-79
9 Savini C.,; "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR. Validation Report and Protocol" Online Publication (2012)
EURL_GMFF 2012-01-27_MON87460_validated_Method.pdf
EURL_GMFF 2012-01-27_MON87460_val_report.pdf
Reference Position 1-79
10 Savini C.,; "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7" Online Publication (2012)
EURL_GMFF 2012-08-15_EURL-VL-10-10 VM_JRC76621
EURL_GMFF 2012-08-13_EURL-VL-10 10 VR_JRC76621
Reference Position 1-79
11 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2015)
EURL_GMFF EURL-VL-03-12-VR.pdf
EURL_GMFF EURL-VL-03-12-VM.pdf
Reference Position 1-79
12 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2016)
EURL_GMFF EURL-VL-01-15-VR.pdf
EURL_GMFF EURL-VL-01-15-VP.pdf
Reference Position 1-79
13 "See Cross-references below" Online Publication (2010)
Reference Position 1-79
Cross-references
GMOMETHODS QT-ELE-00-003;
QT-EVE-ZM-020;
QT-EVE-ZM-010;
QT-EVE-ZM-012;
QT-EVE-ZM-017;
QT-EVE-ZM-016;
QT-EVE-ZM-018;
QT-EVE-ZM-021;
QT-EVE-ZM-005;
QT-EVE-ZM-004;
QT-EVE-ZM-003;
QT-EVE-ZM-024;
Features
Key Location Qualifier Value
STS 1..79 standard_namePCR 79 bp amplicon
notetaxon-specific RT-PCR for maize
targethigh-mobility-group (hmg) gene
primer_b 1..23 standard_namePrimer forward: ZM1-F
noteTTGGACTAGAAATCTCGTGCTGA
targethmg
primer_b complement(34..56) standard_nameRT-PCR probe: Probe ZM1
noteFAM-CAATCCACACAAACGCACGCGTA-TAMRA
primer_b complement(58..79) standard_namePrimer reverse: ZM1-R
noteGCTACATAGGGAGCCTTGTCCT
targethmg
Sequence information
Length: 79 BP, A Count: 16, C Count: 13, T Count: 28, G Count: 22
ttggactaga aatctcgtgc tgannnnnnn nnntacgcgt gcgtttgtgt ggattgnagg        60
acaaggctcc ctatgtagc                                                     79