Entry information |
Entry name | QT-TAX-ZM-002; |
GMO Unique Identifier | |
Description |
Description | Quantitative PCR method for detection of maize high-mobility-group gene |
Keywords | taxon_specific, validated_in_combination. |
From | Zea mays (maize) |
References |
1 | "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods" ISO 21570:1-103 (2005) ISO | 34615 | Reference Position | 1-79 |
|
2 | Mazzara M., Grazioli E., Savini C., Van Den Eede G.; "Report on the Verification of the Performance of a MON810 Event-specific Method on Maize Line MON810 Using Real-time PCR - Validation Report and Protocol" Online Publication (2009) |
3 | Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line TC1507 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7" Online Publication (2005) |
4 | Mazzara M., Grazioli E., Larcher S., Savini C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line DAS-59122-7 Using Real-Time PCR - Validation Report and Protocol" Online Publication (2006) |
5 | Charles Delobel C., Grazioli E., Larcher S., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008) |
6 | Charles Delobel C., Foti N., Grazioli E., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MON88017 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008) |
7 | Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008) |
8 | Savini C., ; "Event-specific Method for the Quantification of Maize 98140 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011) |
9 | Savini C.,; "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR. Validation Report and Protocol" Online Publication (2012) |
10 | Savini C.,; "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7" Online Publication (2012) |
11 | European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2015) |
12 | European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2016) |
13 | "See Cross-references below" Online Publication (2010) |
Cross-references |
GMOMETHODS | QT-ELE-00-003; |
QT-EVE-ZM-020; |
QT-EVE-ZM-010; |
QT-EVE-ZM-012; |
QT-EVE-ZM-017; |
QT-EVE-ZM-016; |
QT-EVE-ZM-018; |
QT-EVE-ZM-021; |
QT-EVE-ZM-005; |
QT-EVE-ZM-004; |
QT-EVE-ZM-003; |
QT-EVE-ZM-024; |
Features |
Key | Location | Qualifier | Value | STS | 1..79 | standard_name | PCR 79 bp amplicon | note | taxon-specific RT-PCR for maize | target | high-mobility-group (hmg) gene | primer_b | 1..23 | standard_name | Primer forward: ZM1-F | note | TTGGACTAGAAATCTCGTGCTGA | target | hmg | primer_b | complement(34..56) | standard_name | RT-PCR probe: Probe ZM1 | note | FAM-CAATCCACACAAACGCACGCGTA-TAMRA | primer_b | complement(58..79) | standard_name | Primer reverse: ZM1-R | note | GCTACATAGGGAGCCTTGTCCT | target | hmg |
|
Sequence information |
Length: 79 BP, A Count: 16, C Count: 13, T Count: 28, G Count: 22 |
ttggactaga aatctcgtgc tgannnnnnn nnntacgcgt gcgtttgtgt ggattgnagg 60
acaaggctcc ctatgtagc 79
|