| Entry information |
|---|
| Entry name | QT-TAX-ZM-002; |
| GMO Unique Identifier | |
| Description |
|---|
| Description | Quantitative PCR method for detection of maize high-mobility-group gene |
| Keywords | taxon_specific, validated_in_combination. |
| From | Zea mays (maize) |
| References |
|---|
| 1 | "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods" ISO 21570:1-103 (2005)
| ISO | 34615 | | Reference Position | 1-79 |
|
| 2 | Mazzara M., Grazioli E., Savini C., Van Den Eede G.; "Report on the Verification of the Performance of a MON810 Event-specific Method on Maize Line MON810 Using Real-time PCR - Validation Report and Protocol" Online Publication (2009)
|
| 3 | Mazzara M., Foti N., Price S., Paoletti C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line TC1507 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7" Online Publication (2005)
|
| 4 | Mazzara M., Grazioli E., Larcher S., Savini C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Maize Line DAS-59122-7 Using Real-Time PCR - Validation Report and Protocol" Online Publication (2006)
|
| 5 | Charles Delobel C., Grazioli E., Larcher S., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line LY038 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
|
| 6 | Charles Delobel C., Foti N., Grazioli E., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MON88017 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
|
| 7 | Savini C., Bogni A., Grazioli E., Munaro B., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Maize Line MON89034 Using Real-time PCR - Validation Report and Protocol" Online Publication (2008)
|
| 8 | Savini C., ; "Event-specific Method for the Quantification of Maize 98140 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
|
| 9 | Savini C.,; "Event-specific Method for the Quantification of Maize MON87460 Using Real-time PCR. Validation Report and Protocol" Online Publication (2012)
|
| 10 | Savini C.,; "Event-specific Method for the Quantification of Maize DAS-40278-9 by Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Maize TC15O7" Online Publication (2012)
|
| 11 | European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON 87427 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2015)
|
| 12 | European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2016)
|
| 13 | "See Cross-references below" Online Publication (2010)
|
| Cross-references |
|---|
| GMOMETHODS | QT-ELE-00-003; |
| QT-EVE-ZM-020; |
| QT-EVE-ZM-010; |
| QT-EVE-ZM-012; |
| QT-EVE-ZM-017; |
| QT-EVE-ZM-016; |
| QT-EVE-ZM-018; |
| QT-EVE-ZM-021; |
| QT-EVE-ZM-005; |
| QT-EVE-ZM-004; |
| QT-EVE-ZM-003; |
| QT-EVE-ZM-024; |
| Features |
|---|
| Key | Location | Qualifier | Value |
|---|
| STS | 1..79 | standard_name | PCR 79 bp amplicon | | note | taxon-specific RT-PCR for maize | | target | high-mobility-group (hmg) gene | | primer_b | 1..23 | standard_name | Primer forward: ZM1-F | | note | TTGGACTAGAAATCTCGTGCTGA | | target | hmg | | primer_b | complement(34..56) | standard_name | RT-PCR probe: Probe ZM1 | | note | FAM-CAATCCACACAAACGCACGCGTA-TAMRA | | primer_b | complement(58..79) | standard_name | Primer reverse: ZM1-R | | note | GCTACATAGGGAGCCTTGTCCT | | target | hmg |
|
| Sequence information |
|---|
| Length: 79 BP, A Count: 16, C Count: 13, T Count: 28, G Count: 22 |
ttggactaga aatctcgtgc tgannnnnnn nnntacgcgt gcgtttgtgt ggattgnagg 60
acaaggctcc ctatgtagc 79
|
