European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-ST-010;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of potato UDP-glucose pyrophosphorylase gene (Savini et al., 2006).
Keywords taxon_specific, validated_in_combination.
From Solanum tuberosum (potato)
References
1 Savini C., Foti N., Mazzara M., Charles Delobel C., Van Den Eede G.; "Event-specific Method for the Quantification of Event EH92-527-1 Potato Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Potato" Online Publication (2006)
DOI 10.2788/30418
Reference Position 1-89
2 "See Cross-references below" Online Publication (2010)
Reference Position 1-89
Cross-references
GMOMETHODS QT-EVE-ST-001;
Features
Key Location Qualifier Value
gene 1..89 geneUGPase
alleleLemhi10
STS complement(1..89) standard_namePCR 88 bp amplicon
notetaxon-specific RT-PCR for potato
targetUDP-glucose pyrophosphorylase (UGPase) gene
primer_b 1..21 standard_namePrimer forward: UGP-af7
noteGGACATGTGAAGAGACGGAGC
targetUGPase
primer_b complement(36..62) standard_nameRT-PCR probe: UGP-sf1
noteFAM-CTACCACCATTACCTCGCACCTCCTCA-TAMRA
primer_b complement(70..89) standard_namePrimer reverse: UGP-ar8
noteCCTACCTCTACCCCTCCGC
noteBased on the sequence coming from GenBank record with accession number U20345, between the 17th and 18th nucleotide of the reverse primer (C and G, respectively) is expected an additional nucleotide A. In the CRL dossier concerning GMO event EH92-527-1 potato this 2250th nucleotide of the GenBank sequence is deleted
targetUGPase
Sequence information
Length: 89 BP, A Count: 18, C Count: 5, T Count: 10, G Count: 35
ggacatgtga agagacggag cnnnnnnnnn nnnnntgagg aggtgcgagg taatggtggt        60
agnnnnnnng cnggaggggt agaggtagg                                          89