European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-OS-017;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of rice Phospholipase D alpha 2 gene (Mazzara et al., 2006).
Keywords taxon_specific, validated_in_combination.
From Oryza sativa Japonica Group (rice)
References
1 Mazzara M., Grazioli E., Savini C., Van Den Eede G.; "Event-specific Method for the Quantitation of Rice Line LLRICE62 Using Real-time PCR -Validation Report and Protocol - Sampling and DNA Extraction of Rice" Online Publication (2006)
DOI 10.2788/31940
Reference Position 1-68
2 "See Cross-references below" Online Publication (2010)
Reference Position 1-68
Cross-references
GMOMETHODS QT-EVE-OS-002;
Features
Key Location Qualifier Value
STS 1..68 geneOs06g0604400
standard_namePCR 68 bp amplicon
notetaxon-specific RT-PCR
targetphospholipase D (PLD) gene
primer_b 1..20 standard_namePrimer forward: KVM159
noteTGGTGAGCGTTTTGCAGTCT
targetPLD
primer_b 22..44 standard_nameRT-PCR probe: TM013
noteFAM-TGTTGTGCTGCCAATGTGGCCTG-TAMRA
primer_b complement(47..68) standard_namePrimer reverse: KVM160
noteCTGATCCACTAGCAGGAGGTCC
targetPLD
Sequence information
Length: 68 BP, A Count: 8, C Count: 14, T Count: 21, G Count: 22
tggtgagcgt tttgcagtct ntgttgtgct gccaatgtgg cctgnnggac ctcctgctag        60
tggatcag                                                                 68