European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-OS-002;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of rice phospholipase D alpha 2 gene (Jacchia et al., 2015)
Keywords Taxon_specific , validated_in_combination.
From Oryza sativa (rice)
References
1 Jacchia S., Nardini E., Bassani N., Savini C., Shim J-H., Trijatmiko K., Kreysa J., Mazzara M.; " International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method" J. Agric. Food Chem. 63:4954-4965 (2015)
DOI 10.1021/acs.jafc.5b00951
Reference Position 1-124
2 Jacchia S., Nardini E., Savini C., Petrillo M., Angers-Loustau A., Shim J-H., Trijatmiko K., Kreysa J., Mazzara M.; " Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay" J. Agric. Food Chem. 63:1711-1721 (2015)
DOI 10.1021/jf505516y
Reference Position 1-124
3 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-TAX-OS-002.pdf
Reference Position 1-124
Cross-references
GMOMETHODS QT-EVE-OS-001;
Features
Key Location Qualifier Value
STS 1..124 standard_namePCR 124 bp amplicon
notetaxon-specific RT-PCR for rice
targetphospholipase D alpha 2 (PLD) gene
primer_b 1..22 standard_namePrimer forward: PLD-GR For
noteGGCAAGAACAACACCATTGACA
targetPLD ?2
primer_b 52..73 standard_nameRT-PCR probe: PLD-GR Probe
noteFAM-ATTCGCCGCGCCAAGAACTTCA-TAMRA
primer_b complement(106..124) standard_namePrimer reverse: PLD-GR Rev
noteCGGCTTTCCATGCAAATGA
targetPLD ?2
Sequence information
Length: 124 BP, A Count: 39, C Count: 36, T Count: 24, G Count: 25
ggcaagaaca acaccattga cannnnnnnn nnnnnnnnnn nnnnnnnnnn nattcgccgc        60
gccaagaact tcannnnnnn nnnnnnnnnn nnnnnnnnnn nnnnntcatt tgcatggaaa       120
gccg                                                                    124