European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-GM-002;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of soybean lectin gene
Keywords taxon_specific, validated_in_combination.
From Glycine max (soybean)
References
1 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods" ISO 21570:1-103 (2005)
ISO 34615
Reference Position 1-74
2 Mazzara M., Munaro B., Larcher S., Grazioli E., Charles Delobel C., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Line 40-3-2 Using Real-time PCR - Validation Report and Protocol - Report on the Validation of a DNA Extraction Method for Soybean Seeds. Online Publication (2007)
DOI 10.2788/61824
Reference Position 1-74
3 Charles Delobel C., Bogni A., Pinski G., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Line MON89788 - Validation Report and Protocol" Online Publication (2008)
DOI 10.2788/44579
Reference Position 1-74
4 Mazzara M., Munaro B., Grazioli E., Savini C., Charles Delobel C., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Event DP-356043-5 Using Real-time PCR - Validation Report and Protocol" Online Publication (2009)
DOI 10.2788/5751
Reference Position 1-74
5 Mazzara M., Munaro B., Grazioli E., Savini C., Charles Delobel C., Van Den Eede G.; "Event-specific Method for the Quantification of Soybean Event DP-305423-1 Using Real-time PCR - Validation Report and Protocol" Online Publication (2009)
DOI 10.2788/57423
Reference Position 1-74
6 Delobel C., Mazzara M., Grazioli E., Van den Eede G.; "Event-specific Method for the Quantification of Soybean MON87701 by Real-time PCR - Validation Report and Validated Method" Online Publication (2011)
DOI 10.2788/38101
Reference Position 1-74
7 Savini C., Mazzara M., Pinski G., Van den Eede G.; "Event-specific Method for the Quantification of Soybean CV127 by Real-time PCR - Validation Report and Validated Method" Online Publication (2011)
DOI 10.2788/37626
Reference Position 1-74
8 Mazzara M., Delobel C., Pinski G., Savini C., Van den Eede G.; "Event-specific Method for the Quantification of Soybean MON87769 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2012)
DOI 10.2788/4544
Reference Position 1-74
9 Savini C.,Mazzara M., Delobel C., Pinski G., Van den Eede G.; "Event-specific Method for the Quantification of Soybean MON87705 Using Real-time PCR - Validation Report and Validated Method Online Publication (2012)
DOI 10.2788/48383
Reference Position 1-74
10 Savini C., Mazzara M., Munaro B., Kreysa J.; "Event-specific Method for the Quantification of Soybean MON87708 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2013)
DOI 10.2788/90943
Reference Position 1-74
11 Savini C., Sacco M.G., Mazzara M., Kreysa J.; "Event-specific Method for the Quantification of Soybean DAS-68416-4 Using Real-time PCR. Validation Report and Validated Method" Online Publication (2014)
DOI 10.2788/87396
Reference Position 1-74
12 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean DAS-81419-2 by Real-time PCR - Validation Report and Validated Method" Online Publication (2015)
EURL_GMFF EURLVL0313VR%20Soybean%20DAS-81419-2%20.pdf
EURL_GMFF EURLVL0313VP_Validated%20method.pdf
Reference Position 1-74
13 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean DAS-44406-6 by Real-time PCR - Validation Report and Validated Method" Online Publication (2015)
EURL_GMFF EURL-VL-0112%20VR_Final.pdf
EURL_GMFF EURL-VL-01-12_VP_Final.pdf
Reference Position 1-74
14 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean MON 87751 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2016)
EURL_GMFF EURL-VL-03-14-VR.pdf
EURL_GMFF MON-87751-Validated-Method.pdf
Reference Position 1-74
15 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR - JRC Validated Methods, Reference Methods and Measurements Reports" Online Publication (2016)
EURL_GMFF EURL-VL-04-12-VR.pdf
EURL_GMFF EURL-VL-04-12-VP.pdf
Reference Position 1-74
16 "See Cross-references below" Online Publication (2010)
Reference Position 1-74
Cross-references
GMOMETHODS QT-CON-00-003;
QT-EVE-GM-005;
QT-EVE-GM-006;
QT-EVE-GM-009;
QT-EVE-GM-008;
QT-EVE-GM-010;
QT-EVE-GM-011;
QT-EVE-GM-002;
QT-EVE-GM-003;
QT-EVE-GM-012;
QT-EVE-GM-013;
QT-EVE-GM-014;
QT-EVE-GM-015;
QT-EVE-GM-016;
QT-EVE-GM-017;
Features
Key Location Qualifier Value
STS 1..74 standard_namePCR 74 bp amplicon
notetaxon-specific RT-PCR for soybean
targetlectin (Le1) gene
primer_b 1..20 standard_namePrimer forward: GM1-F
noteCCAGCTTCGCCGCTTCCTTC
targetLe1
primer_b 23..46 standard_nameRT-PCR probe: GM1
noteFAM-CTTCACCTTCTATGCCCCTGACAC-TAMRA
primer_b complement(52..74) standard_namePrimer reverse: GM1-R
noteGAAGGCAAGCCCATCTGCAAGCC
targetLe1
Sequence information
Length: 74 BP, A Count: 14, C Count: 27, T Count: 20, G Count: 13
ccagcttcgc cgcttccttc nncttcacct tctatgcccc tgacacnnnn nggcttgcag        60
atgggcttgc cttc                                                          74