ID QT-TAX-GM-001; SV 0; linear; genomic DNA; STS; PLN; 81 BP. XX AC ; XX DT 29-MAY-2009 DT 21-JUNE-2013 XX DE Quantitative PCR method for detection of soybean lectin gene XX KW taxon_specific, validated_in_combination. XX OS Glycine max (soybean) XX RN [1] RP 1-81 RA Pauli U., Liniger M., Schrott M., Schouwey B., Huebner P., Brodmann P., RA Eugster A.; RT "Quantitative detection of genetically modified soybean and maize: method RT evaluation in a swiss ring trial"; RL Mitt. Lebensm. Hyg. 92:145-158 (2001). XX RN [2] RP 1-81 RT "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-81 RT "See Cross-references below"; RL Online Publication (2013). XX DR GMOMETHODS; QT-ELE-00-004; XX FH Key Location/Qualifiers FH FT STS 1..81 FT /standard_name="PCR 81 bp amplicon" FT /note="taxon-specific RT-PCR for soybean" FT /target="lectin (Le1) gene" FT primer_bind 1..19 FT /standard_name="Primer forward: Lectin-F" FT /note="TCCACCCCCATCCACATTT" FT /target="Le1" FT primer_bind 30..52 FT /standard_name="RT-PCR probe: Lectin-TMP" FT /note="FAM-AACCGGTAGCGTTGCCAGCTTCG-TAMRA" FT primer_bind complement(58..81) FT /standard_name="Primer reverse: Lectin-R" FT /note="GGCATAGAAGGTGAAGTTGAAGGA" FT /target="Le1" XX SQ Sequence 81 BP; 17 A; 31 C; 13 G; 20 T; 0 other; tccaccccca tccacatttn nnnnnnnnna accggtagcg ttgccagctt cgnnnnntcc 60 ttcaacttca ccttctatgc c 81 //