European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-GH-016;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of putative cotton SAH7 protein gene (123 bp) (Mazzara et al., 2006).
Keywords taxon_specific, validated_in_combination.
From Gossypium hirsutum (upland cotton)
References
1 Mazzara M., Larcher S., Savini C., Charles Delobel C., Van Den Eede G.; "Event-Specific Methods for the Quantitation of the Hybrid Cotton Line 281-24-236/3006-210-23 Using Real-Time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Cotton Seeds" Online Publication (2006)
DOI 10.2788/32649
Reference Position 1-123
2 "See Cross-references below" Online Publication (2010)
Reference Position 1-123
Cross-references
GMOMETHODS QT-EVE-GH-001a;
QT-EVE-GH-001b;
Features
Key Location Qualifier Value
STS 1..123 standard_namePCR 123 bp amplicon
notetaxon-specific RT-PCR
targetIVS of the putative Sinapis Arabidopsis Homolog 7 (SAH7) protein gene of Gossypium hirsutum D-subgenome
primer_b 1..28 standard_namePrimer forward: Sah7-uni-f1
noteAGTTTGTAGGTTTTGATGTTACATTGAG
targetSAH7
primer_b 52..84 standard_nameRT-PCR probe: Sah7-uni-s1
noteFAM-AAACATAAAATAATGGGAACAACCATGACATGT-TAMRA
primer_b complement(103..123) standard_namePrimer reverse: Sah7-uni-r1
noteGCATCTTTGAACCGCCTACTG
targetSAH7
Sequence information
Length: 123 BP, A Count: 29, C Count: 10, T Count: 23, G Count: 20
agtttgtagg ttttgatgtt acattgagnn nnnnnnnnnn nnnnnnnnnn naaacataaa        60
ataatgggaa caaccatgac atgtnnnnnn nnnnnnnnnn nncagtaggc ggttcaaaga       120
tgc                                                                     123