European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-CP-001;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of papaya chymopapain gene
Keywords Taxon_specific, validated_independently.
From Carica papaya (papaya)
References
1 Wei J., Li F., Guo J., Li X., Xu J., Wu G., Zhang D., Yang L.; "Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis" J. Agric. Food Chem. 61:11363-11370 (2013)
DOI 10.1021/jf403338a
Reference Position 1-74
2 Wei J., Le H., Pan A., Xu J., Li F., Li X., Quan S., Guo J., Yang L.; "Collaborative trial for the validation of event-specific PCR detection methods of genetically modified papaya Huanong No. 1" Food Chemistry 194:20-25 (2016)
DOI 10.1016/j.foodchem.2015.07.010
Reference Position 1-74
3 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-TAX-CP-001.pdf
Reference Position 1-74
4 "See Cross-references below" Online Publication (2016)
Reference Position 1-74
Cross-references
GMOMETHODS QT-EVE-CP-001;
Features
Key Location Qualifier Value
STS 1..74 standard_namePCR 74 bp amplicon
notetaxon-specific RT-PCR for papaya
targetchymopapain gene
primer_b 1..17 standard_namePrimer forward: Q-Chy-1F
noteCCATGCGGATCCTCCCA
targetCHY
primer_b 19..46 standard_nameRT-PCR probe: Q-Chy-P
noteFAM-TTCCCTTCATCCATTCCCACTCTTGAGA-3'-BHQ1
misc_fea 28 noteTo increase the fluorescent intensity, the fluorescent quencher dye was labeled on the T-base of the probe within internal position with black-hole quencher 1 (BHQ1)
primer_b complement (48..74) standard_namePrimer reverse: Q-Chy-2R
noteCATCGTAGCCATTGTAACACTAGCTAA
targetCHY
Sequence information
Length: 74 BP, A Count: 15, C Count: 23, T Count: 23, G Count: 13
ccatgcggat cctcccattt cccttcatcc attcccactc ttgagagtta gctagtgtta        60
caatggctac gatg                                                          74