European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-BV-013;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of sugar beet glutamine synthetase GS2 gene (Mazzara et al., 2006).
Keywords taxon_specific, validated_in_combination.
From Beta vulgaris (sugar beet)
References
1 Mazzara M., Foti N., Savini C., Van Den Eede G.; "Event-Specific Method for the Quantitation of Sugarbeet Line H7-1 Using Real-Time PCR - Validation Report and Protocol Online Publication (2006)
DOI 10.2788/32035
Reference Position 1-118
2 "See Cross-references below" Online Publication (2010)
Reference Position 1-118
Cross-references
GMOMETHODS QT-EVE-BV-001;
Features
Key Location Qualifier Value
STS 1..118 geneGNL2
standard_namePCR 118 bp amplicon
notetaxon-specific RT-PCR for sugar beet
targetglutamine synthetase (GS2) gene
primer_b 1..24 standard_namePrimer forward: GluA3-F
noteGACCTCCATATTACTGAAAGGAAG
targetGS2
primer_b 48..74 standard_nameRT-PCR probe: GluD1
noteFAM-CTACGAAGTTTAAAGTATGTGCCGCTC-TAMRA
primer_b complement(96..118) standard_namePrimer reverse: GluA3-R
noteGAGTAATTGCTCCATCCTGTTCA
targetGS2
Sequence information
Length: 118 BP, A Count: 24, C Count: 15, T Count: 18, G Count: 17
gacctccata ttactgaaag gaagnnnnnn nnnnnnnnnn nnnnnnncta cgaagtttaa        60
agtatgtgcc gctcnnnnnn nnnnnnnnnn nnnnntgaac aggatggagc aattactc         118