European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-TAX-BN-012;  
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of oilseed rape cruciferin A gene
Keywords taxon_specific, validated_in_combination.
From Brassica napus (oilseed rape)
References
1 Mazzara M., Grazioli E., Savini C., Van Den Eede G.; Event-Specific Method for the Quantification of Oilseed Rape Line RT73 Using Real-Time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction of Oilseed Rape Online Publication (2007)
DOI 10.2788/33974
Reference Position 1-101
2 Mazzara M., Bogni A., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Oilseed Rape Line Ms8 Using Real-time PCR - Validation Report and Protocol- Seeds Sampling and DNA Extraction of Oilseed Rape" Online Publication (2007)
DOI 10.2788/33880
Reference Position 1-101
3 Savini C., Bogni A., Mazzara M., Van Den Eede G.; "Event-specific Method for the Quantification of Oilseed Rape Line Rf3 Using Real-time PCR - Validation Report and Protocol - Seeds Sampling and DNA Extraction" Online Publication (2007)
DOI 10.2788/28179
Reference Position 1-101
4 Charles Delobel C., Bogni A., Mazzara M., Savini C., Van Den Eede G.; "Event-specific Method for the Quantification of Oilseed Rape Line T45 Using Real-time PCR - Validation Report and Protocol - Sampling and DNA Extraction of Oilseed Rape" Online Publication (2006)
DOI 10.2788/30936
Reference Position 1-101
5 Savini C., ; "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape MS1 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF CRLVL1104 VR.pdf
EURL_GMFF CRLVL1104 VP.pdf
Reference Position 1-101
6 Mazzara M.,; "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF1 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF CRLVL0904 VR.pdf
EURL_GMFF CRLVL0904 VP.pdf
Reference Position 1-101
7 Mazzara M.,; "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape RF2 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF Rf2 Validation Report.pdf
EURL_GMFF Rf2 Validated Method Protocol CRL-VL-1004.pdf
Reference Position 1-101
8 Mazzara M.,; "In-house Validation of an Event-specific Method for the Quantification of Oilseed Rape Topas 19/2 Using Real-time PCR - Validation Report and Protocol" Online Publication (2011)
EURL_GMFF CRLVL1204 VR.pdf
EURL_GMFF CRLVL1204 VP.pdf
Reference Position 1-101
9 "See Cross-references below" Online Publication (2010)
Reference Position 1-101
Cross-references
GMOMETHODS QT-EVE-BN-004;
QT-EVE-BN-002;
QT-EVE-BN-003;
QT-EVE-BN-001;
QT-EVE-BN-005;
QT-EVE-BN-006;
QT-EVE-BN-007;
QT-EVE-BN-008;
Features
Key Location Qualifier Value
STS complement(1..101) standard_namePCR 101 bp amplicon
notetaxon-specific RT-PCR for oilseed rape
targetcruciferin A (CruA) gene
primer_b 1..18 standard_namePrimer forward: MDB510
noteGGCCAGGGTTTCCGTGAT
targetCruA
primer_b complement(20..48) standard_nameRT-PCR probe: TM003
noteVIC-AGTCCTTATGTGCTCCACTTTCTGGTGCA-TAMRA
primer_b complement(81..101) standard_namePrimer reverse: MDB511
noteCCGTCGTTGTAGAACCATTGG
targetCruA
Sequence information
Length: 101 BP, A Count: 19, C Count: 16, T Count: 13, G Count: 20
ggccagggtt tccgtgatnt gcaccagaaa gtggagcaca taaggactnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn ccaatggttc tacaacgacg g                           101