European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-028;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-00098-3
Description
Description Quantitative PCR method for detection of maize event MZIR098 (EURL GMFF, 2018).
Keywords event_specific.
From Zea mays (maize) - event MZIR098 (SYN-00098-3)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MZIR098 Using Real-time PCR - Validation Report" Online Publication (2018)
EURL_GMFF EURL-VL-04-17-VR.pdf
EURL_GMFF EURL-VL-04-17-VM.pdf
Reference Position 1-73
2 "PCR reactions set up and amplification conditions" Online Publication (2018)
PCR QT-EVE-ZM-028.pdf
Reference Position 1-73
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..73 standard_namePCR 73 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event MZIR098 and the maize host genome
primer_b 1..23 standard_namePrimer forward: MZIR098 forward primer
noteATCTCAGACACCAAACCGAGATC
target5'-host genome
primer_b 24..49 standard_nameRT-PCR probe: MZIR098 probe
noteFAM-CAAGTGACAGCGAACGGAGCTGGTTT-BHQ1
primer_b complement(52..73) standard_namePrimer reverse: MZIR098 reverse primer
noteACACCGTTAGGCTAGTGCCAGT
targetinsert
Sequence information
Length: 73 BP, A Count: 23, C Count: 19, T Count: 13, G Count: 18
atctcagaca ccaaaccgag atccaagtga cagcgaacgg agctggtttn nactggcact        60
agcctaacgg tgt                                                           73