European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-027;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-000JG-2
Description
Description Quantitative PCR method for detection of maize event MZHG0JG (EURL GMFF, 2018).
Keywords event_specific.
From Zea mays (maize) - event MZHG0JG (SYN-000JG-2)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MZHG0JG Using Real-time PCR - Validation Report" Online Publication (2018)
EURL_GMFF EURL-VL-04-16-VM.pdf
EURL_GMFF EURL-VL-04-16-VR.pdf
Reference Position 1-81
2 "PCR reactions set up and amplification conditions" Online Publication (2018)
PCR QT-EVE-ZM-027.pdf
Reference Position 1-81
Cross-references
GMOMETHODS QT-TAX-ZM-014;
Features
Key Location Qualifier Value
STS 1..81 standard_namePCR 81 bp amplicon
noteEvent-specific RT-PCR
target3' integration border region (IBR) between the insert of maize event MZHG0JG and the maize host genome
primer_b 1..29 standard_namePrimer forward: MZHG0JG forward primer
noteCAACTAGCTAGATTAATTAACGCAATCTG
targetinsert
primer_b 33..56 standard_nameRT-PCR probe: MZHG0JG probe
noteFAM-TTAAGTTGTCTAAGCGTCAATTTG-BHQ
primer_b complement(61..81) standard_namePrimer reverse: MZHG0JG reverse primer
noteATTTGTTTGCAAGGTGTGGGA
target3'-host genome
Sequence information
Length: 81 BP, A Count: 26, C Count: 17, T Count: 27, G Count: 11
caactagcta gattaattaa cgcaatctgn nnttaagttg tctaagcgtc aatttgnnnn        60
tcccacacct tgcaaacaaa t                                                  81