European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-026;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier DP-004114-3
Description
Description Quantitative PCR method for detection of maize event 4114 (EURL GMFF, 2018).
Keywords event_specific.
From Zea mays (maize) - event 4114 (DP-004114-3)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize DP-004114-3 Using Real-time PCR - Validation Report" Online Publication (2018)
EURL_GMFF EURL-VL-02-14-VP.pdf
EURL_GMFF EURL-VL-02-14-VR.pdf
Reference Position 1-80
2 "PCR reactions set up and amplification conditions" Online Publication (2018)
PCR QT-EVE-ZM-026.pdf
Reference Position 1-80
Cross-references
GMOMETHODS QT-TAX-ZM-005;
Features
Key Location Qualifier Value
STS 1..80 standard_namePCR 80 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of maize event 4114 and the maize host genome
primer_b 1..22 standard_namePrimer forward: PHN164689
noteGCTTTGGAGCCTCTCGTTTGTA
target5'-host genome
primer_b 24..50 standard_nameRT-PCR probe: PHN164691
noteFAM-CACTTGCACGTAGTTACCCGGACCGAA-BHQ
primer_b complement(53..80) standard_namePrimer reverse: PHN1641690
noteGCGTTTAAACTATCAGATCTGTGTTGAA
targetinsert
Sequence information
Length: 80 BP, A Count: 19, C Count: 21, T Count: 22, G Count: 18
gctttggagc ctctcgtttg tancacttgc acgtagttac ccggaccgaa nnttcaacac        60
agatctgata gtttaaacgc                                                    80