European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-025;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87403-1
Description
Description Quantitative PCR method for detection of maize event MON 87403 (EURL GMFF, 2018).
Keywords event_specific.
From Zea mays (maize) - event MON87403 (MON-87403-1)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON 87403 Using Real-time PCR - Validation Report" Online Publication (2018)
EURL_GMFF EURL-VL-02-15-VM.pdf
EURL_GMFF EURL-VL-02-15-VR.pdf
Reference Position 1-88
2 "PCR reactions set up and amplification conditions" Online Publication (2018)
PCR QT-EVE-ZM-025.pdf
Reference Position 1-88
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..88 standard_namePCR 88 bp amplicon
note"Event-specific RT-PCR;
target3' integration border region (IBR) between the insert of maize event MON87403 and the maize host genome
primer_b 1..30 standard_namePrimer forward: 87403 QF
noteCTTTCTTTTTCTCCATATTGACCATCATAC
targetinsert
primer_b 31..58 standard_nameRT-PCR probe: 87403 QP
noteFAM-TCATTGCGATCCACATTTCCCTACATGG-TAMRA
primer_b complement(64..88) standard_namePrimer reverse: 87403 QR
noteTACTCCGGAATGAGTGCTCTGTATC
target3'-host genome
Sequence information
Length: 88 BP, A Count: 21, C Count: 24, T Count: 29, G Count: 14
ctttcttttt ctccatattg accatcatac tcattgcgat ccacatttcc ctacatggnn        60
nnngatacag agcactcatt ccggagta                                           88