European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-024;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87411-9
Description
Description Quantitative PCR method for detection of maize event MON87411(EURL GMFF, 2016).
Keywords event_specific.
From Zea mays (maize) - event MON87411 (MON-87411-9)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize MON87411 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2016)
EURL_GMFF EURL-VL-01-15-VR.pdf
EURL_GMFF EURL-VL-01-15-VP.pdf
Reference Position 1-109
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-EVE-ZM-024.pdf
Reference Position 1-109
Cross-references
GMOMETHODS QT-TAX-ZM-002;
Features
Key Location Qualifier Value
STS 1..109 standard_namePCR 109 bp amplicon
note"Event-specific RT-PCR;
target3' integration border region (IBR) between the insert of maize event MON87411 and the maize host genome
primer_b 1..27 standard_namePrimer forward: 87411 QF
noteCTCTGTAACAGAAAACACCATCTAGAG
targetinsert
primer_b 31..60 standard_nameRT-PCR probe: 87411 QP
noteFAM-CCGCGTTTAAACTATCAGTGTTTAGAGAAT-TAMRA
primer_b complement(82..109) standard_namePrimer reverse: 87411 QR
noteACAAAAGTGAACTAGTTCTAGGGTAGAT
target3'-host genome
Sequence information
Length: 109 BP, A Count: 35, C Count: 25, T Count: 32, G Count: 17
ctctgtaaca gaaaacacca tctagagnnn ccgcgtttaa actatcagtg tttagagaat        60
nnnnnnnnnn nnnnnnnnnn natctaccct agaactagtt cacttttgt                   109