European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-ZM-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier VCO-01981-5
Description
Description Quantitative PCR method for detection of maize event VCO-01981-5 (EURL GMFF, 2016).
Keywords event_specific.
From Zea mays (maize) - event VCO-01981-5 (VCO-01981-5)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Maize VCO-01981-5 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2016)
EURL_GMFF EURL-VL-07-12-VR.pdf
EURL_GMFF EURL-VL-07-12-VP.pdf
Reference Position 1-85
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-EVE-ZM-001.pdf
Reference Position 1-85
Cross-references
GMOMETHODS QT-TAX-ZM-004;
Features
Key Location Qualifier Value
STS 1..85 standard_namePCR 85 bp amplicon
note"Event-specific RT-PCR;
target5' integration border region (IBR) between the insert of maize event VCO-01981-5 and the maize host genome
primer_b 1..22 standard_namePrimer forward: VCO-01981-5 primer F
noteCCACTGAACGTCACCAAGAAGA
target5'-host genome
primer_b 24..43 standard_nameRT-PCR probe: VCO-01981-5 probe
noteFAM-CAGTACTCAAACACTGATAG-MGB
primer_b complement(66..85) standard_namePrimer reverse: VCO-01981-5 primer R
noteGCCGCTACTCGAGGGATTTA
targetinsert
Sequence information
Length: 85 BP, A Count: 31, C Count: 20, T Count: 19, G Count: 15
ccactgaacg tcaccaagaa gancagtact caaacactga tagnnnnnnn nnnnnnnnnn        60
nnnnntaaat ccctcgagta gcggc                                              85