European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-OS-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of rice event Golden Rice 2 (Jacchia et al., 2015)
Keywords event_specific.
From Oryza sativa (rice) - event Golden Rice 2 (GR2)
References
1 Jacchia S., Nardini E., Bassani N., Savini C., Shim J-H., Trijatmiko K., Kreysa J., Mazzara M.; " International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method" J. Agric. Food Chem. 63:4954-4965 (2015)
DOI 10.1021/acs.jafc.5b00951
Reference Position 1-121
2 Jacchia S., Nardini E., Savini C., Petrillo M., Angers-Loustau A., Shim J-H., Trijatmiko K., Kreysa J., Mazzara M.; " Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay" J. Agric. Food Chem. 63:1711-1721 (2015)
DOI 10.1021/jf505516y
Reference Position 1-121
3 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-EVE-OS-001.pdf
Reference Position 1-121
Cross-references
GMOMETHODS QT-TAX-OS-002;
Features
Key Location Qualifier Value
STS 1..121 standard_namePCR 121 bp amplicon
noteevent-specific RT-PCR
target3' integration border region (IBR) between the insert of rice event Golden Rice 2 and the rice host genome
primer_b 1..19 standard_namePrimer forward: GR2 For
noteTGGCCGTATCCGCAATGTG
targetinsert
primer_b 33..59 standard_nameRT-PCR probe: GR2 Probe
noteFAM-TCGATATGATTCCTTCATCGAGCGAGC-TAMRA
primer_b complement(101..121) standard_namePrimer reverse: RB-REV-BS
noteGCTGCGCCTCTAACCAGGTAT
target3'-host genome
Sequence information
Length: 121 BP, A Count: 24, C Count: 27, T Count: 31, G Count: 39
tggccgtatc cgcaatgtgn nnnnnnnnnn nntcgatatg attccttcat cgagcgagcn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn atacctggtt agaggcgcag       120
c                                                                       121