European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-017;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SYN-000H2-5
Description
Description Quantitative PCR method for detection of soybean event SYHT0H2 (EURL GMFF, 2016).
Keywords event_specific.
From Glycine max (soybean) - event SYHT0H2 (SYN-000H2-5)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean SYHT0H2 by Real-time PCR - JRC Validated Methods, Reference Methods and Measurements Reports" Online Publication (2016)
EURL_GMFF EURL-VL-04-12-VR.pdf
EURL_GMFF EURL-VL-04-12-VP.pdf
Reference Position 1-88
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-EVE-GM-017.pdf
Reference Position 1-88
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..88 standard_namePCR 88 bp amplicon
note"Event-specific RT-PCR;
target3' integration border region (IBR) between the insert of soybean event SYHT0H2 and the soybean host genome
primer_b 1..19 standard_namePrimer forward: FE08316-F
noteGGGAATTGGGTACCATGCC
targetinsert
primer_b 27..47 standard_nameRT-PCR probe: FE08318-P
noteFAM-CCAGCATGGCCGTATCCGCAA-BHQ
primer_b complement(68..88) standard_namePrimer reverse: FE08317-R
noteTGTGTGCCATTGGTTTAGGGT
target3'-host genome
Sequence information
Length: 88 BP, A Count: 23, C Count: 23, T Count: 19, G Count: 23
gggaattggg taccatgccn nnnnnnccag catggccgta tccgcaannn nnnnnnnnnn        60
nnnnnnnacc ctaaaccaat ggcacaca                                           88