European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-016;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87751-7
Description
Description Quantitative PCR method for detection of soybean event MON87751 (EURL GMFF, 2016).
Keywords event_specific.
From Glycine max (soybean) - event MON87751 (MON-87751-7)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Soybean MON 87751 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2016)
EURL_GMFF EURL-VL-03-14-VR.pdf
EURL_GMFF MON-87751-Validated-Method.pdf
Reference Position 1-87
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-EVE-GM-016.pdf
Reference Position 1-87
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..87 standard_namePCR 87 bp amplicon
note"Event-specific RT-PCR;
target5' integration border region (IBR) between the insert of soybean event MON87751 and the soybean host genome
primer_b 1..30 standard_namePrimer forward: MON 87751 primer 2
noteCTAAATTGCTCTTTGGAGTTTATTTTGTAG
target5'-host genome
primer_b complement(34..62) standard_nameRT-PCR probe: MON 87751 probe
noteFAM-TGACTGGAGATCTCCAAAGTGAGGGGAAA-TAMRA
primer_b complement(64..87) standard_namePrimer reverse: MON 87751 primer 1
noteGGCCTAACTTTTGGTGTGATGATG
targetinsert
Sequence information
Length: 87 BP, A Count: 22, C Count: 21, T Count: 30, G Count: 14
ctaaattgct ctttggagtt tattttgtag nnntttcccc tcactttgga gatctccagt        60
cancatcatc acaccaaaag ttaggcc                                            87