European Commission > JRC > IHCP > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GM-012;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-87708-9
Description
Description Quantitative PCR method for detection of soybean event MON87708 (Savini et al., 2013).
Keywords event_specific.
From Glycine max (soybean) - event MON87708 (MON-87708-9)
References
1 Savini C., Mazzara M., Munaro B., Kreysa J.; "Event-specific Method for the Quantification of Soybean MON87708 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2013)
DOI 10.2788/90943
Reference Position 1-91
2 "PCR reactions set up and amplification conditions" Online Publication (2013)
PCR QT-EVE-GM-012.pdf
Reference Position 1-91
Cross-references
GMOMETHODS QT-TAX-GM-002;
Features
Key Location Qualifier Value
STS 1..91 standard_namePCR 91 bp amplicon
noteEvent-specific RT-PCR
target3' integration border region (IBR) between the insert of soybean event MON87708 and the soybean host genome
primer_b 1..25 standard_namePrimer forward: MON87708 primer 1
noteTCATACTCATTGCTGATCCATGTAG
targetinsert
primer_b 29..56 standard_nameRT-PCR probe: MON87708 probe
noteFAM-TCCCGGACTTTAGCTCAAAATGCATGTA-TAMRA
primer_b complement(65..91) standard_namePrimer reverse: MON87708 primer 2
noteAGAACAAATTAACGAAAAGACAGAACG
target3'-host genome
Sequence information
Length: 91 BP, A Count: 19, C Count: 18, T Count: 40, G Count: 14
tcatactcat tgctgatcca tgtagnnntc ccggacttta gctcaaaatg catgtannnn        60
nnnncgttct gtcttttcgt taatttgttc t                                       91