European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-GH-010;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-88701-3
Description
Description Quantitative PCR method for detection of cotton event MON88701 (EURL GMFF, 2016).
Keywords event_specific.
From Gossypium hirsutum (upland cotton) - event MON88701 (MON-88701-3)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific Method for the Quantification of Cotton MON88701 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2016)
EURL_GMFF EURL-VL-01-13-VR.pdf
EURL_GMFF MON-88701-Validated-Method.pdf
Reference Position 1-84
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-EVE-GH-010.pdf
Reference Position 1-84
Cross-references
GMOMETHODS QT-TAX-GH-015;
Features
Key Location Qualifier Value
STS 1..84 standard_namePCR 84 bp amplicon
noteEvent-specific RT-PCR
target3' integration border region (IBR) between the insert of cotton event MON88701 and the cotton host genome
primer_b 1..25 standard_namePrimer forward: MON 88701 primer 1
noteCATACTCATTGCTGATCCATGTAGA
targetinsert
primer_b 27..53 standard_nameRT-PCR probe: MON 88701 probe
noteFAM-TTCCCGGACATGAAGCCTTAATTCAAT-TAMRA
primer_b complement(58..84) standard_namePrimer reverse: MON 88701 primer 2
noteAGTGTTAAACAAGTTATGTTCTAGAGC
target3'-host genome
Sequence information
Length: 84 BP, A Count: 25, C Count: 19, T Count: 28, G Count: 12
catactcatt gctgatccat gtaganttcc cggacatgaa gccttaattc aatnnnngct        60
ctagaacata acttgtttaa cact                                               84