European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-CP-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of papaya event Huanong N 1 (Wei et al., 2016).
Keywords event_specific.
From Carica papaya (papaya) - event Huanong No. 1
References
1 Wei J., Le H., Pan A., Xu J., Li F., Li X., Quan S., Guo J., Yang L.; "Collaborative trial for the validation of event-specific PCR detection methods of genetically modified papaya Huanong No. 1" Food Chemistry 194:20-25 (2016)
DOI 10.1016/j.foodchem.2015.07.010
Reference Position 1-175
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QT-EVE-CP-001.pdf
Reference Position 1-175
Cross-references
GMOMETHODS QT-TAX-CP-001;
Features
Key Location Qualifier Value
STS 1..175 standard_namePCR 175 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of papaya event Huanong No 1 and the papaya host genome
misc_fea 1..133 notePapaya genomic sequence, 5' flanking region
primer_b 1..20 standard_namePrimer forward: qHN-F
noteGACGAGTACAAGGAGACGCC
target5'-host genome
primer_b complement(126..151) standard_nameRT-PCR probe: qHN-P
noteFAM-TGGCTGCTATTGGGCGAATCAACTAC-BHQ1
misc_fea complement(134..175) notenptII fragment
primer_b complement(156..175) standard_namePrimer reverse: qHN-R
noteGTTGTCACTGAAGCGGGAAG
targetinsert
Sequence information
Length: 175 BP, A Count: 67, C Count: 31, T Count: 55, G Count: 22
gacgagtaca aggagacgcc ttttaatttg tttaaattaa ataaaaacat aaattattaa        60
gcgacgtaat aataaacacg tcataaattt tttcaaaaaa taaaatttct tttattttct       120
aaaaagtagt tgattcgccc aatagcagcc agtcccttcc cgcttcagtg acaac            175