European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-011;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier BCS-BN012-7
Description
Description Quantitative PCR method for detection of oilseed rape event MS11 (Jacchia et al., 2019).
Keywords event_specific.
From Brassica napus (oilseed rape) - event MS11 (BCS-BN012-7)
References
1 Jacchia S., Sacco M.G., Savini C., Mazzara M., Emons H.; "Event-specific Method for the Quantification of Oilseed Rape MS11 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2019)
EURL_GMFF EURL-VL-03-16-VR.pdf
EURL_GMFF EURL-VL-03-16-VM.pdf
Reference Position 1-124
2 "PCR reactions set up and amplification conditions" Online Publication (2019)
PCR QT-EVE-BN-011.pdf
Reference Position 1-124
Cross-references
GMOMETHODS QT-TAX-BN-003;
Features
Key Location Qualifier Value
STS 1..124 standard_namePCR 124 bp amplicon
noteevent-specific RT-PCR
target3'integration border region (IBR) between the insert of oilseed rape event MS11 and the oilseed rape host genome
primer_b 1..28 standard_namePrimer forward: SHA086
noteCAAGATGGGAATTAACATCTACAAATTG
targetinsert
primer_b 40..59 standard_nameRT-PCR probe: TM280
noteFAM-CGACCATGTACATCCTACCA-MGB
primer_b complement(102..124) standard_namePrimer reverse: MDB371
noteGAAATCCATGTAAAGCAGCAGGG
target3'-host genome
Sequence information
Length: 124 BP, A Count: 39, C Count: 27, T Count: 43, G Count: 15
caagatggga attaacatct acaaattgnn nnnnnnnnnc gaccatgtac atcctaccan        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nccctgctgc tttacatgga       120
tttc                                                                    124