European Commission > JRC > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-EVE-BN-010;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier MON-88302-9
Description
Description Quantitative PCR method for detection of oilseed rape event MON88302 (Savini et al., 2013).
Keywords event_specific.
From Brassica napus (oilseed rape)- event MON88302 (MON-88302-9)
References
1 Savini C., et al.; "Event-specific Method for the Quantification of Oilseed Rape MON88302 Using Real-time PCR - Validation Report and Validated Method" Online Publication (2013)
EURL_GMFF EURL-VL-09-11-VR-MON88302.pdf
EURL_GMFF EURL-VL-09-11-VM-MON88302.pdf
Reference Position 1-101
2 "PCR reactions set up and amplification conditions" Online Publication (2013)
PCR QT-EVE-BN-010.pdf
Reference Position 1-101
Cross-references
GMOMETHODS QT-TAX-BN-002;
Features
Key Location Qualifier Value
STS 1..101 standard_namePCR 101 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of oilseed rape event MON88302 and the oilseed rape host genome
primer_b 1..27 standard_namePrimer forward: 88302QF
noteTCCTTGAACCTTATTTTATAGTGCACA
target5'-host genome
primer_b 36..65 standard_nameRT-PCR probe: 88302QP
noteFAM-TAGTCATCATGTTGTACCACTTCAAACACT-TAMRA
primer_b complement(78..101) standard_namePrimer reverse: 88302QR
noteTCAGATTGTCGTTTCCCGCCTTCA
targetinsert
Sequence information
Length: 101 BP, A Count: 33, C Count: 21, T Count: 31, G Count: 16
tccttgaacc ttattttata gtgcacannn nnnnntagtc atcatgttgt accacttcaa        60
acactnnnnn nnnnnnntga aggcgggaaa cgacaatctg a                           101