ID QT-ELE-00-004; SV 0; linear; genomic DNA; STS; SYN; 82 BP. XX AC ; XX DT 29-MAY-2009 DT 20-JUNE-2013 XX DE Quantitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter XX KW element_specific. XX RN [1] RP 1-82 RA Pauli U., Liniger M., Schrott M., Schouwey B., Huebner P., Brodmann P., RA Eugster A.; RT "Quantitative detection of genetically modified soybean and maize: method RT evaluation in a swiss ring trial"; RL Mitt. Lebensm. Hyg. 92:145-158 (2001). XX RN [2] RP 1-82 RT "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-82 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2013). RX PCR=QT-ELE-00-004.pdf XX DR GMOMETHODS; QT-TAX-GM-001; XX FH Key Location/Qualifiers FH FT STS 1..82 FT /standard_name="PCR 82 bp amplicon" FT /note="element-specific RT-PCR" FT /target="Cauliflower Mosaic Virus 35S promoter (CaMV P-35S)" FT primer_bind 1..18 FT /standard_name="Primer forward: 35S-F" FT /note="GCCTCTGCCGACAGTGGT" FT /target="CaMV P-35S" FT primer_bind 21..42 FT /standard_name="RT-PCR probe: 35S-TMP" FT /note="FAM-CAAAGATGGACCCCCACCCACG-TAMRA" FT primer_bind complement(61..82) FT /standard_name="Primer reverse: 35S-R" FT /note="AAGACGTGGTTGGAACGTCTTC" FT /target="CaMV P-35S" XX SQ Sequence 82 BP; 23 A; 27 C; 20 G; 12 T; 0 other; gcctctgccg acagtggtnn caaagatgga cccccaccca cgnnnnnnnn nnnnnnnnnn 60 gaagacgttc caaccacgtc tt 82 //