Entry information |
Entry name | QT-ELE-00-004; See in JRC GMO-Matrix See in JRC GMO-Amplicons |
GMO Unique Identifier | |
Description |
Description | Quantitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter |
Keywords | element_specific. |
1 | Pauli U., Liniger M., Schrott M., Schouwey B., Huebner P., Brodmann P., Eugster A.; "Quantitative detection of genetically modified soybean and maize: method evaluation in a swiss ring trial" Mitt. Lebensm. Hyg. 92:145-158 (2001) |
2 | "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods" ISO 21570:1-103 (2005) ISO | 34615 | Reference Position | 1-82 |
|
3 | "PCR reactions set up and amplification conditions" Online Publication (2013) |
Cross-references |
GMOMETHODS | QT-TAX-GM-001; |
Features |
Key | Location | Qualifier | Value | STS | 1..82 | standard_name | PCR 82 bp amplicon | note | element-specific RT-PCR | target | Cauliflower Mosaic Virus 35S promoter (CaMV P-35S) | primer_b | 1..18 | standard_name | Primer forward: 35S-F | note | GCCTCTGCCGACAGTGGT | target | CaMV P-35S | primer_b | 21..42 | standard_name | RT-PCR probe: 35S-TMP | note | FAM-CAAAGATGGACCCCCACCCACG-TAMRA | primer_b | complement(61..82) | standard_name | Primer reverse: 35S-R | note | AAGACGTGGTTGGAACGTCTTC | target | CaMV P-35S |
|
Sequence information |
Length: 82 BP, A Count: 23, C Count: 27, T Count: 12, G Count: 20 |
gcctctgccg acagtggtnn caaagatgga cccccaccca cgnnnnnnnn nnnnnnnnnn 60
gaagacgttc caaccacgtc tt 82
|