European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-ELE-00-004;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of Cauliflower Mosaic Virus 35S promoter
Keywords element_specific.
1 Pauli U., Liniger M., Schrott M., Schouwey B., Huebner P., Brodmann P., Eugster A.; "Quantitative detection of genetically modified soybean and maize: method evaluation in a swiss ring trial" Mitt. Lebensm. Hyg. 92:145-158 (2001)
Reference Position 1-82
2 "Foodstuffs - Methods of analysis for the detection of genetically modified organisms and derived products - Quantitative nucleic acid based methods" ISO 21570:1-103 (2005)
ISO 34615
Reference Position 1-82
3 "PCR reactions set up and amplification conditions" Online Publication (2013)
PCR QT-ELE-00-004.pdf
Reference Position 1-82
Cross-references
GMOMETHODS QT-TAX-GM-001;
Features
Key Location Qualifier Value
STS 1..82 standard_namePCR 82 bp amplicon
noteelement-specific RT-PCR
targetCauliflower Mosaic Virus 35S promoter (CaMV P-35S)
primer_b 1..18 standard_namePrimer forward: 35S-F
noteGCCTCTGCCGACAGTGGT
targetCaMV P-35S
primer_b 21..42 standard_nameRT-PCR probe: 35S-TMP
noteFAM-CAAAGATGGACCCCCACCCACG-TAMRA
primer_b complement(61..82) standard_namePrimer reverse: 35S-R
noteAAGACGTGGTTGGAACGTCTTC
targetCaMV P-35S
Sequence information
Length: 82 BP, A Count: 23, C Count: 27, T Count: 12, G Count: 20
gcctctgccg acagtggtnn caaagatgga cccccaccca cgnnnnnnnn nnnnnnnnnn        60
gaagacgttc caaccacgtc tt                                                 82