European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QT-ELE-00-002;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Quantitative PCR method for detection of phosphinothricin N-acetyltransferase gene (Weighard et al., 2004).
Keywords element_specific.
1 Weighardt F., Barbati C., Paoletti C., Querci M., Kay S., De Beuckeleer M., Van den Eede G.; "Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event" J AOAC Int 87:1342-1355 (2004)
PUBMED 15675446
Reference Position 1-68
2 "PCR reactions set up and amplification conditions" Online Publication (2010)
PCR QT-ELE-00-002.pdf
Reference Position 1-68
Features
Key Location Qualifier Value
STS 1..68 standard_namePCR 68 bp amplicon
noteelement-specific RT-PCR
targetPhosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes
primer_b 1..21 standard_namePrimer forward: KVM-5
noteTTGAGGGTGTTGTGGCTGGTA
targetpat
primer_b complement(23..44) standard_nameRT-PCR probe: Pat1
noteFAM-CTTCCAGGGCCCAGCGTAAGCA-TAMRA
primer_b complement(48..68) standard_namePrimer reverse: KVM-6
noteTGTCCAATCGTAAGCGTTCCT
targetpat
Sequence information
Length: 68 BP, A Count: 12, C Count: 12, T Count: 19, G Count: 25
ttgagggtgt tgtggctggt antgcttacg ctgggccctg gaagnnnagg aacgcttacg        60
attggaca                                                                 68