ID QT-CON-00-005; SV 0; linear; genomic DNA; STS; SYN; 149 BP. XX AC ACS-ZM003-2; XX DT 15-SEP-2009 DT 05-OCT-2016 XX DE Quantitative PCR method for detection of the junction between the phosphinothricin N-acetyltransferase gene and the CaMV 35S terminator. XX KW construct_specific. XX OS Zea mays (maize) - event T25 (ACS-ZM003-2) XX RN [1] RP 1-149 RA Shindo Y., Kuribara H., Matsuoka T., Futo S., Sawada C., Shono J., RA Akiyama H., Goda Y., Toyoda M., Hino A.; RT "Validation of real-time PCR analyses for line-specific quantitation of RT genetically modified maize and soybean using new reference molecules"; RL J AOAC Int 85:1119-1126 (2002). RX PUBMED; 12374412. XX RN [2] RP 1-149 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Quantitative nucleic acid based RT methods"; RL ISO 21570:1-103 (2005). RX ISO=34615 XX RN [3] RP 1-149 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QT-CON-00-005.pdf XX DR GMOMETHODS; QT-TAX-ZM-006; XX FH Key Location/Qualifiers FH FT STS 1..149 FT /standard_name="PCR 149 bp amplicon" FT /note="Construct-specific RT-PCR" FT /target="Junction region between the phosphinothricin N-acetyltransferase (pat) gene from Streptomyces viridochromogenes and the Cauliflower Mosaic Virus 35S terminator (CaMV T-35S)" FT primer_bind 1..21 FT /standard_name="Primer forward: T25 1-5'" FT /note="GCCAGTTAGGCCAGTTACCCA" FT /target="pat" FT primer_bind 36..57 FT /standard_name="RT-PCR probe: T25-2-Taq" FT /note="FAM-TGCAGGCATGCCCGCTGAAATC-TAMRA" FT primer_bind complement(126..149) FT /standard_name="Primer reverse: T25 1-3'" FT /note="TGAGCGAAACCCTATAAGAACCCT" FT /target="CaMV T-35S" XX SQ Sequence 149 BP; 37 A; 37 C; 32 G; 43 T; 0 other; gccagttagg ccagttaccc annnnnnnnn nnnnntgcag gcatgcccgc tgaaatcnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnagggt tcttataggg tttcgctca 149 //