European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-TAX-PS-001;  
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of pea lectin gene (Debode et al., 2016).
Keywords taxon_specific, validated_independently.
From Pisum sativum (pea)
References
1 Debode F., Huber I., Macarthur R., Rischitor P.E., Mazzara M., Herau V., Sebah D., Dobnik D., Broeders S., Roosens N.H., Busch U., Berben G., Morisset D., Zel J.; " Inter-laboratory studies for the validation of two singleplex (tE9 and pea lectin) and one duplex (pat/bar) real-time PCR methods for GMO detection" Food Control 73:452-461 (2017)
DOI 10.1016/j.foodcont.2016.08.037
Reference Position 1-78
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-TAX-PS-001.pdf
Reference Position 1-78
Features
Key Location Qualifier Value
STS 1..78 standard_namePCR 78 bp amplicon
notetaxon-specific RT-PCR for pea
targetpea lectin (psl) gene
primer_b 1..24 standard_namePrimer forward: lecPea1-F
noteTGGAATCGATGTGAACAGTATCAA
targetpsl
primer_b 26..52 standard_nameRT-PCR probe: lecPea1-P
noteFAM-TCCGTAAACACTAAGTCGTGGAAGTTG-TAMRA
primer_b complement(54..78) standard_namePrimer reverse: lecPea1-R
noteACAACATTAGCCTCTTCACCATTCT
targetpsl
Sequence information
Length: 78 BP, A Count: 26, C Count: 10, T Count: 20, G Count: 22
tggaatcgat gtgaacagta tcaaatccgt aaacactaag tcgtggaagt tgcagaatgg        60
tgaagaggct aatgttgt                                                      78