European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-TAX-DC-001;  
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of carnation anthocyanidin synthase gene.
Keywords taxon_specific, validated_in_combination.
From Dianthus caryophyllus (carnation)
References
1 Savini C., Querci M., Moens W., Mazzara M., Cordeil S., Van den Eede G.; "Report on the Testing of a PCR-based Detection Method for Identification of FlorigeneTM Moonlite GM Carnation - Protocol Version 2" Online Publication (2007)
EURL_2001 CRL_Report_Flor_Moonlite_v2.pdf
Reference Position 1-1279
2 Savini C., Brustio R., Bogni A., Mazzara M., Kreysa J.; "Report on the single-laboratory validation of a PCR-based Detection Method for Identification of FlorigeneTM IFD-25958-3 GM Carnation - Validation Report and Validated Method" Online Publication (2012)
DOI 10.2788/76760
Reference Position 1-1279
3 Savini C., Pinski G., Mazzara M., Kreysa J.; "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of FlorigeneTM 26407 GM Carnation - Validation Report and Validated Method" Online Publication (2013)
DOI 10.2788/34771
Reference Position 1-1279
4 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of SHD-27531-4 GM Carnation - JRC Validated Methods, Reference Methods and Measurement Reports" Online Publication (2016)
EURL_2001 EURL-EV-01-13-Final-Report.pdf
Reference Position 1-1279
5 "See Cross-references below" Online Publication (2016)
Reference Position 1-1279
Cross-references
GMOMETHODS QL-EVE-DC-001;
QL-EVE-DC-003;
QL-EVE-DC-004;
QL-EVE-DC-005;
Features
Key Location Qualifier Value
/note="This sequence has been obtained by manual annotation of record GenBank:AB727362.2, Dianthus caryophyllus genomic DNA, anthocyanidin synthase promoter region. "
STS 1..1279 standard_namePCR 1279 bp amplicon
note"taxon-specific PCR for carnation;
targetanthocyanidin synthase gene
primer_b 1..22 standard_namePrimer forward: ANS.F
noteCTAGATCGGAGGTCACCATACC
targetANS
primer_b complement(1259..1279) standard_namePrimer reverse: ANS.R
noteGAAACCGTGACCATGGTCTCG
targetANS
Sequence information
Length: 1279 BP, A Count: 352, C Count: 250, T Count: 405, G Count: 272
ctagatcgga ggtcaccata cccgtgaaga tttttctgtg agaggaaaag aacccaagga        60
cgaggttcaa atctacacat ggaaagacgc cacgcttcgt gagttaactg accttgtatg       120
tcgccatcgc ttagcgtagc gctgaacatc gttttcaccc tgctccatcc atcaaccatt       180
tattggtctt atacatgtgt gattgcgttg ttcttacatt taggtgaaag acgtttctcc       240
agctgctagg agtcgagatg cgaaattgtc gtttgcgact gtataccttg atagaaatgg       300
atgcatgcaa gtaaagaagg tatcttctaa ttcatctttc gtagagacat agcgtgaatt       360
tggacggggt ctttggtttg agaaagataa cagctttacg tatttttgta gatgggtgaa       420
accttttcaa atccgtataa gcgtaaagac gacaactggg ctttagggga cacattcttt       480
caggtataat tgatgcgact aacaatagtc tccactgatc atattctact cttctacgtt       540
cgatactgac tgtttctggt tatttggtag acaggagatt atttggacgt agcaattcag       600
tagcgtagag atgtttccac acgtgttatc gtaaaagaag caagataagc ctaatgccta       660
gggtggtggt atgacttccg ttgcttatcg atcgtgcttg taagtaattt ccgtcttatc       720
ttttcctgtt atataaagtt aatcttctct aggactttca tgaaccttgt ttgtgtattt       780
atttctcgat caacatgata gagctagttt ttaagcaacg tatactagta gtctattgga       840
agttaagaca cggttcttaa aaaggtacga tccaagtgaa gcatgttaga tatgacactt       900
tcttctaggg acgactctcg tatgccaccc gactttttca attttttttg tgaatgttag       960
atgtgtgtat ataatgcatc cgaaagatgt ctcaacgaac aaatgagcca cctacttcga      1020
tcactcgcta tcaatgttat taatgccttg ttgattttaa tagttgatca ataatagtaa      1080
aatctattca agggtatagt ctcccgttca cactcatcgg ggttacacta gcgagctcca      1140
ttaatcggtg ccttaatcga gacgctaaga actataccat gacctagtca gcgccatggg      1200
actgatgtag gccacacaat ctcgatgatc cgaaaacgct agagttcaag acctagttcg      1260
agaccatggt cacggtttc                                                   1279