European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-TAX-CP-001;  
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of papaya chymopapain gene (Wei et al., 2013).
Keywords Taxon_specific, validated_independently.
From Carica papaya (papaya)
References
1 Wei J., Li F., Guo J., Li X., Xu J., Wu G., Zhang D., Yang L.; "Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis" J. Agric. Food Chem. 61:11363-11370 (2013)
DOI 10.1021/jf403338a
Reference Position 1-282
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-TAX-CP-001.pdf
Reference Position 1-282
Features
Key Location Qualifier Value
STS 1..282 standard_namePCR 282 bp amplicon
notetaxon-specific PCR for papaya
targetchymopapain gene
primer_b 1..22 standard_namePrimer forward: Chy-1F
noteATCTACAATCTTGCTAACCCTA
targetCHY
primer_b complement(261..282) standard_namePrimer reverse: Chy-2R
noteAGTCATCTTGAGAATAACCCAC
targetCHY
Sequence information
Length: 282 BP, A Count: 84, C Count: 55, T Count: 94, G Count: 49
atctacaatc ttgctaaccc taaaatgacg gtgcaagtag agtgaatgac aagatctttt        60
atttagagag aaagaaactt gattgaaaag acaagctagt atataaaccc atgcggatcc       120
tcccatttcc cttcatccat tcccactctt gagagttagc tagtgttaca atggctacga       180
tgagttcaat ttcaaaaatt attttcttgg caacatgtct cattattcat atgggtttgt       240
cttctgctga tttttacacc gtgggttatt ctcaagatga ct                          282