ID QL-EVE-ZM-002; SV 0; linear; genomic DNA; STS; SYN; 117 BP. XX AC ; XX DT 15-DEC-2005 DT 13-DEC-2011 XX DE Qualitative PCR method for detection of maize event Bt10 (verified by the EU-RL GMFF in the context of Commission Decision 317/2005/EC) XX KW event_specific, EU-RL_GMFF_in-house_verified. XX OS Zea mays (maize) - event Bt10 XX RN [1] RP 1-117 RA Mazzara M., Foti N., Maretti M., Savini C., Van den Eede G.; RT "Report on the In-House Validation of an event-specific Detection Method RT for Event Bt10 using a qualitative PCR assay and verification by RT restriction analysis - Scientific Report - Version 2"; RL Online Publication (2005). RX EURL_GMFF=Bt10 validation report version2.pdf XX RN [2] RP 1-117 RA Van den Eede G.; RT "PCR Assay for Detection of Maize Transgenic Event Bt10 - Scientific RT Report - Version 2"; RL Online Publication (2005). RX EURL_GMFF=Bt10 Detection Protocol version2.pdf XX RN [3] RP 1-117 RA Van den Eede G.; RT "Molecular characterization of GM event Bt10. Summary report on RT scientific data obtained at the JRC-GMO-CRL and an analysis of the data RT on Bt10, obtained by Syngenta"; RL Online Publication (2006). RX EURL_GMFF=Bt10_Executive summary.pdf XX RN [4] RP 1-117 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2011). RX PCR=QL-EVE-ZM-002.pdf XX FH Key Location/Qualifiers FH FT STS 1..117 FT /standard_name="PCR 117 bp amplicon" FT /note="Event-specific RT-PCR" FT /target="Not provided" FT primer_bind 1..29 FT /standard_name="Primer forward: JSF5" FT /note="CACACAGGAGATTATTATAGGGTTACTCA" FT /target="Not provided" FT primer_bind complement(90..117) FT /standard_name="Primer reverse: JSR5" FT /note="ACACGGAAATGTTGAATACTCATACTCT" FT /target="Not provided" XX SQ Sequence 117 BP; 42 A; 20 C; 21 G; 34 T; 0 other; cacacaggag attattatag ggttactcan nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnna gagtatgagt attcaacatt tccgtgt 117 //