ID QL-EVE-ZM-001; SV 0; linear; genomic DNA; STS; SYN; 170 BP. XX AC MON-00810-6; XX DT 23-JUN-2009 DT 23-SEP-2010 XX DE Qualitative PCR method for detection of maize event MON810 DE (ISO/FDIS 21569:2005). XX KW event_specific. XX OS Zea mays (maize) - event MON810 (MON-00810-6) XX RN [1] RP 1-170 RT "Foodstuffs - Methods of analysis for the detection of genetically RT modified organisms and derived products - Qualitative nucleic acid based RT methods"; RL ISO 21569:1-69 (2005). RX ISO=34614 XX RN [2] RP 1-170 RT "Detection of a genetic modification of maize (Zea mays L.) by RT amplification of the modified DNA sequence by means of the polymerase RT chain reaction (PCR) and hybridization of the PCR product with a DNA RT probe or restriction analysis of the PCR product, N. L 15.05-1"; RL Online Publication (2002). XX RN [3] RP 1-170 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2010). RX PCR=QL-EVE-ZM-001.pdf XX DR GMOMETHODS; QL-TAX-ZM-003; XX FH Key Location/Qualifiers FH FT STS 1..170 FT /standard_name="PCR 170 bp amplicon" FT /note="Event-specific PCR" FT /target="5' integration border region (IBR) between the insert of maize event MON810 and the maize host genome" FT primer_bind 1..23 FT /standard_name="Primer forward: VW01" FT /note="TCGAAGGACGAAGGACTCTAACG" FT /target="5'-host genome" FT primer_bind complement(149..170) FT /standard_name="Primer reverse: VW03" FT /note="TCCATCTTTGGGACCACTGTCG" FT /target="CaMV P-35S" XX SQ Sequence 170 BP; 50 A; 37 C; 42 G; 41 T; 0 other; tcgaaggacg aaggactcta acgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 120 nnnnnnnnnn nnnnnnnnnn nnnnnnnncg acagtggtcc caaagatgga 170 //