European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-EVE-EC-002;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of E. coli K-12 event 19E (EURL GMFF, 2015).
Keywords event_specific.
From Escherichia coli K-12 (bacteria) - event 19E
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Event-specific method for the detection of dried-killed bacterial biomass PL73 (LM) derived from Escherichia coli K-12 GM strain 19E using real-time PCR - JRC Validated Methods, Reference Methods and Measurements Reports" Online Publication (2015)
EURL_GMFF CRL-VL-06-08-VR.pdf
EURL_GMFF CRL-VL-06-08-VP.pdf
Reference Position 1-85
2 "PCR reactions set up and amplification conditions" Online Publication (2017)
PCR QL-EVE-EC-002.pdf
Reference Position 1-85
Features
Key Location Qualifier Value
STS 1..85 standard_namePCR 85 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of E. coli K-12 event 19E and the bacterial host genome
primer_b 1..27 standard_namePrimer forward: LMA for
noteGGTTATCCAGTAATAGCCATCTTCATC
target5'-host genome
primer_b 38..63 standard_nameRT-PCR probe: LMA probe
noteFAM-CCGTCGCCGCTGTATTGATTCACTTG-TAMRA
primer_b complement(64..85) standard_namePrimer reverse: LMA rev
noteCCTCCCGGTTTTTTTCGTACTT
targetinsert
Sequence information
Length: 85 BP, A Count: 22, C Count: 22, T Count: 19, G Count: 22
ggttatccag taatagccat cttcatcnnn nnnnnnnccg tcgccgctgt attgattcac        60
ttgaagtacg aaaaaaaccg ggagg                                              85