European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-EVE-EC-001;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier
Description
Description Qualitative PCR method for detection of E. coli K-12 event AG3139 (Mazzara et al., 2009).
Keywords event_specific.
From Escherichia coli K-12 (bacteria) - event AG3139
References
1 Mazzara M., Foti N., Savini C., Bonfini L., Van den Eede G.; "Event-specific method for the detection of dried-killed bacterial biomass PT73 (TM) derived from E. coli GM strain AG3139 using real-time PCR - Validation Report and Protocol" Online Publication (2009)
DOI 10.2788/58900
Reference Position 1-90
2 "PCR reactions set up and amplification conditions" Online Publication (2017)
PCR QL-EVE-EC-001.pdf
Reference Position 1-90
Features
Key Location Qualifier Value
STS 1..90 standard_namePCR 90 bp amplicon
noteEvent-specific RT-PCR
target5' integration border region (IBR) between the insert of E. coli K-12 event AG3139 and the bacterial host genome
primer_b 1..30 standard_namePrimer forward: TMD-For
noteAATACCGTTAAACGTAAATTCTTTTTCTTT
target5'-host genome
primer_b 33..68 standard_nameRT-PCR probe: TMD-probe
noteFAM-AGATCGAGTATTCATTCGGTGTATTGATTCACTTGA-TAMRA
primer_b complement(71..90) standard_namePrimer reverse: TMD-Rev
noteTCCTCCCGGTTTTTTTCGTA
targetinsert
Sequence information
Length: 90 BP, A Count: 30, C Count: 13, T Count: 30, G Count: 17
aataccgtta aacgtaaatt ctttttcttt nnagatcgag tattcattcg gtgtattgat        60
tcacttgann tacgaaaaaa accgggagga                                         90