ID QL-EVE-EC-001; SV 0; linear; unassigned DNA; STS; SYN; 90 BP. XX AC ; XX DT 23-JUN-2008 DT 23-NOV-2017 XX DE Qualitative PCR method for detection of E. coli K-12 event AG3139 (Mazzara et al., 2009). XX KW event_specific. XX OS Escherichia coli K-12 (bacteria) - event AG3139 XX RN [1] RP 1-90 RA Mazzara M., Foti N., Savini C., Bonfini L., Van den Eede G.; RT "Event-specific method for the detection of dried-killed bacterial biomass PT73 (TM) derived from E. coli GM strain AG3139 using real-time PCR - Validation Report and Protocol"; RL Online Publication (2009). RX DOI=10.2788/58900. XX RN [2] RP 1-90 RT "PCR reactions set up and amplification conditions"; RL Online Publication (2017). RX PCR=QL-EVE-EC-001.pdf XX FH Key Location/Qualifiers FH FT STS 1..90 FT /standard_name="PCR 90 bp amplicon" FT /note="Event-specific RT-PCR"; FT /target="5' integration border region (IBR) between the insert of E. coli K-12 event AG3139 and the bacterial host genome"; FT primer_bind 1..30 FT /standard_name="Primer forward: TMD-For" FT /note="AATACCGTTAAACGTAAATTCTTTTTCTTT" FT /target="5'-host genome" FT primer_bind 33..68 FT /standard_name="RT-PCR probe: TMD-probe" FT /note="FAM-AGATCGAGTATTCATTCGGTGTATTGATTCACTTGA-TAMRA" FT primer_bind complement(71..90) FT /standard_name="Primer reverse: TMD-Rev" FT /note="TCCTCCCGGTTTTTTTCGTA" FT /target="insert" XX SQ Sequence 90 BP; 30 A; 13 C; 17 G; 30 T; 0 other; aataccgtta aacgtaaatt ctttttcttt nnagatcgag tattcattcg gtgtattgat 60 tcacttgann tacgaaaaaa accgggagga 90 //