European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-EVE-DC-006;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier FLO-40685-2
Description
Description Qualitative PCR method for detection of carnation event 123.8.8 (verified by the EURL GMFF, 2016).
Keywords event_specific, EURL_GMFF_in-house_verified.
From Dianthus caryophyllus (carnation) - event 123.8.8 (FLO-40685-2)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of GM-line FLO-40685-2 Carnation - JRC Validated Methods, Reference Methods and Measurement Reports" Online Publication (2016)
EURL_2001 EURL-EV-02-13-VR.pdf
Reference Position 1-338
2 "PCR reactions set up and amplification conditions" Online Publication (2017)
PCR QL-EVE-DC-006.pdf
Reference Position 1-338
Cross-references
GMOMETHODS QL-TAX-DC-001;
Comment
NOTE: This GMO was formerly referred to with the FLO-40685-1 Unique identifiers (UI) which OECD corrected (JAN 2015).
Features
Key Location Qualifier Value
STS 1..338 standard_namePCR 338 bp amplicon
noteEvent-specific PCR for the second insertion site of GMO event 123.8.8 carnation
target3' integration border region (IBR) between the insert of carnation event 123.8.8 and the carnation host genome
primer_b 1..22 standard_namePrimer forward: RBF1a
noteTGGTGGACCCTTGAGGAAACTG
targetinsert
primer_b complement(317..338) standard_namePrimer reverse: 123.8.8-2.1R
noteATACAATGGCTGACTGATGTAG
target3'-host genome
Sequence information
Length: 338 BP, A Count: 90, C Count: 60, T Count: 106, G Count: 82
tggtggaccc ttgaggaaac tgnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
nnnnnnnnnn nnnnnnctac atcagtcagc cattgtat                               338