European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-EVE-DC-005;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier SHD-27531-4
Description
Description Qualitative PCR method for detection of carnation event 27531 (verified by the EURL GMFF in the context of Commission Implementing Decision (EU) 2016/2050).
Keywords event_specific, EU-RL_GMFF_in-house_verified.
From Dianthus caryophyllus (carnation) - event 27531 (SHD-27531-4)
References
1 European Union Reference Laboratory for GM Food and Feed (EURL GMFF), Joint Research Centre (JRC), European Commission; "Report on the Single-laboratory Validation of a PCR-based Detection Method for Identification of SHD-27531-4 GM Carnation - JRC Validated Methods, Reference Methods and Measurement Reports" Online Publication (2016)
EURL_2001 EURL-EV-01-13-Final-Report.pdf
Reference Position 1-458
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-EVE-DC-005.pdf
Reference Position 1-458
Cross-references
GMOMETHODS QL-TAX-DC-001;
Features
Key Location Qualifier Value
STS 1..458 standard_namePCR 458 bp amplicon
noteEvent-specific PCR
target5' integration border region (IBR) between the insert of carnation event 27531 and the carnation host genome
primer_b 1..21 standard_namePrimer forward: 27531 LB Specific fw
noteCGAGTAAATTCAAGCATGCCC
target5'-host genome
primer_b complement(434..458) standard_namePrimer reverse: carLB-reverse
noteCCATATTGACCATCATACTCATTGC
targetinsert
Sequence information
Length: 458 BP, A Count: 160, C Count: 74, T Count: 131, G Count: 93
cgagtaaatt caagcatgcc cnnnnnnnnn nnnnnnnnnn nnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       420
nnnnnnnnnn nnngcaatga gtatgatggt caatatgg                               458