European Commission > EU Science Hub > EU-RL GMFF
Legal Notice   Privacy statement   English (EN)
GMOMETHODS:
EU Database of Reference Methods for GMO Analysis
Search for Select by GMO Unique Identifier:
Entry information
Entry name QL-EVE-DC-003;       See in JRC GMO-Matrix       See in JRC GMO-Amplicons
GMO Unique Identifier IFD-25958-3
Description
Description Qualitative PCR method for detection of carnation event 25958 (verified by the EURL GMFF in the context of Commission Implementing Decision (EU) 2015/692).
Keywords event_specific, EU-RL_GMFF_in-house_verified.
From Dianthus caryophyllus (carnation) - event 25958 (IFD-25958-3)
References
1 Savini C., Brustio R., Bogni A., Mazzara M., Kreysa J.; "Report on the single-laboratory validation of a PCR-based Detection Method for Identification of FlorigeneTM IFD-25958-3 GM Carnation - Validation Report and Validated Method" Online Publication (2012)
DOI 10.2788/76760
Reference Position 1-482
2 "PCR reactions set up and amplification conditions" Online Publication (2016)
PCR QL-EVE-DC-003.pdf
Reference Position 1-482
Cross-references
GMOMETHODS QL-TAX-DC-001;
Features
Key Location Qualifier Value
STS 1..482 standard_namePCR 482 bp amplicon
noteEvent-specific PCR
target3' integration border region (IBR) between the insert of carnation event 25958 and the carnation host genome
primer_b 1..24 standard_namePrimer forward: RB Forward
noteTGGACCCTTGAGGAAACTGGTAGC
targetinsert
primer_b complement(462..482) standard_namePrimer reverse: IFD-25958-3 Reverse
noteCTTGTACACCGCGTTATGCTC
target3'-host genome
Sequence information
Length: 482 BP, A Count: 126, C Count: 89, T Count: 164, G Count: 103
tggacccttg aggaaactgg tagcnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn        60
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       120
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       180
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       240
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       300
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       360
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn       420
nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn ngagcataac gcggtgtaca       480
ag                                                                      482